{"type": "FeatureCollection", "features": [{"id": "10.1016/j.biocon.2022.109475", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-24T16:16:27Z", "type": "Journal Article", "created": "2022-03-15", "title": "In defence of soil biodiversity: Towards an inclusive protection in the European Union", "description": "Open AccessSince soil biodiversity sustains above-ground life, the European Union (EU) has recently announced its new Soil Strategy to better protect soil ecosystems as part of the Biodiversity Strategy for 2030. Also, the EU\u2019s Farm to Fork Strategy and the Zero Pollution Action Plan aim for soil protection. However, the status of soil biodiversity protection has not been comprehensively assessed. Therefore, we explored regulatory, incentive-based and knowledge-based instruments and strategic policy documents at the EU and national levels to determine whether they adequately protect soil biodiversity. Our review of 507 literature references concluded that only eight EU member states explicitly address threats to soil biodiversity in 14 regulatory instruments while 13 countries mainly focus on implicit threats to soil biodiversity, whereas six countries do not consider soil biodiversity. At the EU level, current directives and regulations only tackle individual threats to soil biodiversity. An EU-wide, legally binding protection could ensure a standardised minimum level of soil biodiversity protection while preventing surging costs of not acting. The EU Soil Health Law foreseen for 2023 could couple land management practices beneficial for soil biodiversity with incentive-based instruments. Simultaneously, models should be designed to predict soil biodiversity, considering soil biodiversity\u2019s spatial and temporal heterogeneity.", "keywords": ["2. Zero hunger", "2511.06 Conservaci\u00f3n de Suelos", "13. Climate action", "Common Agricultural Policy", " Green Deal", " Soil biodiversity conservation", " Soil governance", " Soil protection", "11. Sustainability", "0401 agriculture", " forestry", " and fisheries", "04 agricultural and veterinary sciences", "15. Life on land", "01 natural sciences", "0105 earth and related environmental sciences", "12. Responsible consumption"], "contacts": [{"organization": "K\u00f6ninger, J., Panagos, P., Jones, A., Briones, M.J.I., Orgiazzi, A.,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1016/j.biocon.2022.109475"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biological%20Conservation", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.biocon.2022.109475", "name": "item", "description": "10.1016/j.biocon.2022.109475", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.biocon.2022.109475"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-04-01T00:00:00Z"}}, {"id": "10.1016/j.pedobi.2017.05.003", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-24T16:17:20Z", "type": "Journal Article", "created": "2017-05-13", "title": "Priorities for research in soil ecology", "description": "The ecological interactions that occur in and with soil are of consequence in many ecosystems on the planet. These interactions provide numerous essential ecosystem services, and the sustainable management of soils has attracted increasing scientific and public attention. Although soil ecology emerged as an independent field of research many decades ago, and we have gained important insights into the functioning of soils, there still are fundamental aspects that need to be better understood to ensure that the ecosystem services that soils provide are not lost and that soils can be used in a sustainable way. In this perspectives paper, we highlight some of the major knowledge gaps that should be prioritized in soil ecological research. These research priorities were compiled based on an online survey of 32 editors of Pedobiologia - Journal of Soil Ecology. These editors work at universities and research centers in Europe, North America, Asia, and Australia.The questions were categorized into four themes: (1) soil biodiversity and biogeography, (2) interactions and the functioning of ecosystems, (3) global change and soil management, and (4) new directions. The respondents identified priorities that may be achievable in the near future, as well as several that are currently achievable but remain open. While some of the identified barriers to progress were technological in nature, many respondents cited a need for substantial leadership and goodwill among members of the soil ecology research community, including the need for multi-institutional partnerships, and had substantial concerns regarding the loss of taxonomic expertise.", "keywords": ["0301 basic medicine", "aboveground-belowground interactions", "Biologia", "Aboveground-belowground interactions", "910", "soil processes", "soil microbial ecology", "Microbial ecology", "Novel environments", "Soil food web", "11. Sustainability", "Climate change", "0503 Soil Sciences", "Global change", "biodiversity", "ecosystem management", "2. Zero hunger", "biodiversity\u2013ecosystem functioning", "0303 health sciences", "Plant-microbe interaction", "Agronomy & Agriculture", "Soil processes", "climate change", "ekosysteemipalvelut", "Biogeography", "international", "570", "Soil management", "Ecosystem service", "Biodiversity\u2013ecosystem functioning", "0607 Plant Biology", "plant-microbe interactions", "soil biodiversity", "Chemical ecology", "Aboveground-belowground interactions; Biodiversity\u2013ecosystem functioning; Biogeography; Chemical ecology; Climate change; Ecosystem services; Global change; Microbial ecology; Novel environments; Plant-microbe interactions; Soil biodiversity; Soil food web; Soil management; Soil processes", "climatic changes", "eli\u00f6maantiede", "12. Responsible consumption", "Aboveground-belowground interaction", "03 medical and health sciences", "soil food web", "Novel environment", "XXXXXX - Unknown", "Ecosystem services", "Biology", "global change", "maaper\u00e4nsuojelu", "chemical ecology", "500", "15. Life on land", "Soil biodiversity", "biodiversiteetti", "ekosysteemit (ekologia)", "mikrobiekologia", "13. Climate action", "ilmastonmuutos", "novel environments", "ta1181", "soil management", "Plant-microbe interactions", "0703 Crop And Pasture Production"]}, "links": [{"href": "https://usiena-air.unisi.it/bitstream/11365/1134372/2/Eisenhauer_et_al_research_priorities_20170503.pdf"}, {"href": "https://doi.org/10.1016/j.pedobi.2017.05.003"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Pedobiologia", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.pedobi.2017.05.003", "name": "item", "description": "10.1016/j.pedobi.2017.05.003", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.pedobi.2017.05.003"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2017-07-01T00:00:00Z"}}, {"id": "10.1111/ejss.13470", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-24T16:19:19Z", "type": "Journal Article", "created": "2024-03-14", "title": "Participatory soil citizen science: An unexploited resource for European soil research", "description": "Abstract<p>Soils are key components of our ecosystems and provide 95%\uffe2\uff80\uff9399% of our food. This importance is reflected by an increase in participatory citizen science projects on soils. Citizen science is a participatory research method that actively involves and engages the public in scientific enquiry to generate new knowledge or understanding. Here, we review past and current citizen science projects on agricultural soils across Europe. We conducted a web\uffe2\uff80\uff90based survey and described 24 reviewed European citizen science projects in the light of the 10 principles of citizen science and identified success factors for citizen science. Over 66% of the projects generated soil biodiversity data; 54% and 42% of the projects generated data on vegetation cover and soil organic carbon, respectively. Our findings show that soil citizen science projects aligned with the 10 principles of citizen science offer an unexploited resource for European soil health research. We conclude that promoting co\uffe2\uff80\uff90creation, fostering knowledge\uffe2\uff80\uff90sharing networks and enabling long\uffe2\uff80\uff90term communication and commitment with citizens are success factors for further development of citizen science on soils.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "570", "web-based survey", "soil health", "soil biodiversity", "[SDV.SA.SDS]Life Sciences [q-bio]/Agricultural sciences/Soil study", "15. Life on land", "01 natural sciences", "333", "12. Responsible consumption", "03 medical and health sciences", "13. Climate action", "EJPSOIL", "EJPSOIL", " European agroecosystems", " participatory research", " soil biodiversity", " soil health", " web-based survey", "11. Sustainability", "European agroecosystems", "participatory research", "[SDV.SA.SDS] Life Sciences [q-bio]/Agricultural sciences/Soil study", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://iris.cnr.it/bitstream/20.500.14243/469825/1/2024_European%20J%20Soil%20Scienc_Mason.pdf"}, {"href": "https://doi.org/10.1111/ejss.13470"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/ejss.13470", "name": "item", "description": "10.1111/ejss.13470", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/ejss.13470"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-03-01T00:00:00Z"}}, {"id": "10.1186/s12862-022-02089-4", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-24T16:19:59Z", "type": "Journal Article", "created": "2022-11-17", "title": "Land use and soil characteristics affect soil organisms differently from above-ground assemblages", "description": "Abstract                 Background                 <p>Land-use is a major driver of changes in biodiversity worldwide, but studies have overwhelmingly focused on above-ground taxa: the effects on soil biodiversity are less well known, despite the importance of soil organisms in ecosystem functioning. We modelled data from a global biodiversity database to compare how the abundance of soil-dwelling and above-ground organisms responded to land use and soil properties.</p>                                Results                 <p>We found that land use affects overall abundance differently in soil and above-ground assemblages. The abundance of soil organisms was markedly lower in cropland and plantation habitats than in primary vegetation and pasture. Soil properties influenced the abundance of soil biota in ways that differed among land uses, suggesting they shape both abundance and its response to land use.</p>                                Conclusions                 <p>Our results caution against assuming models or indicators derived from above-ground data can apply to soil assemblages and highlight the potential value of incorporating soil properties into biodiversity models.</p>", "keywords": ["Land-use intensity", "0106 biological sciences", "570", "Evolution", "[SDV]Life Sciences [q-bio]", "Organism abundance", "soil biodiversity", "01 natural sciences", "soil biota", "mixed-effects models", "Soil", "land\u2011use intensity", "Land-use", " Land-use intensity", " Mixed-effects models", " Organism abundance", " Soil biodiversity", " Soil biota", "land-use", "QH359-425", "Soil biota", "land-use intensity", "Biology", "Land-use", "QH540-549.5", "Ecosystem", "Soil Microbiology", "2. Zero hunger", "Ecology", "Research", "Biology and Life Sciences", "Biodiversity", "04 agricultural and veterinary sciences", "15. Life on land", "organism abundance", "Soil biodiversity", "Biota", "[SDV] Life Sciences [q-bio]", "Chemistry", "land\u2011use", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Human medicine", "Mixed-effects models", "mixed\u2011effects models"]}, "links": [{"href": "https://www.iris.unict.it/bitstream/20.500.11769/647835/1/12862_2022_Article_2089.pdf"}, {"href": "https://doi.org/10.1186/s12862-022-02089-4"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/BMC%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1186/s12862-022-02089-4", "name": "item", "description": "10.1186/s12862-022-02089-4", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1186/s12862-022-02089-4"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-17T00:00:00Z"}}, {"id": "10.25674/so92iss2pp121", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-24T16:21:19Z", "type": "Journal Article", "title": "Lessons from the WBF2020: extrinsic and intrinsic value of soil organisms", "description": "Following our participation in the first World Biodiversity Forum in Davos, Switzerland, we provide a summary of the main themes of the conference, as well as an overview of the session that was focused on soil biodiversity. One of the main themes of the conference was the valuation of biodiversity and what contributes to the value of biodiversity. In this article we explore whether we should move away from the notion that we can only 'sell' soil biodiversity based on the function and services it provides, and rather shift towards valuing soil biodiversity based on its intrinsic value and our relationship with it.", "keywords": ["0301 basic medicine", "0303 health sciences", "ecosystem functions and services", "Biodiversity", "15. Life on land", "Microbiology", "QR1-502", "03 medical and health sciences", "QL1-991", "13. Climate action", "intrinsic value", "world biodiversity forum", "Zoology", "valuing soil biodiversity", "Taxonomy"]}, "links": [{"href": "https://doi.org/10.25674/so92iss2pp121"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20organisms", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.25674/so92iss2pp121", "name": "item", "description": "10.25674/so92iss2pp121", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.25674/so92iss2pp121"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-01-01T00:00:00Z"}}, {"id": "10044/1/101414", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-24T16:25:23Z", "type": "Journal Article", "created": "2022-11-17", "title": "Land use and soil characteristics affect soil organisms differently from above-ground assemblages", "description": "Abstract                 Background                 <p>Land-use is a major driver of changes in biodiversity worldwide, but studies have overwhelmingly focused on above-ground taxa: the effects on soil biodiversity are less well known, despite the importance of soil organisms in ecosystem functioning. We modelled data from a global biodiversity database to compare how the abundance of soil-dwelling and above-ground organisms responded to land use and soil properties.</p>                                Results                 <p>We found that land use affects overall abundance differently in soil and above-ground assemblages. The abundance of soil organisms was markedly lower in cropland and plantation habitats than in primary vegetation and pasture. Soil properties influenced the abundance of soil biota in ways that differed among land uses, suggesting they shape both abundance and its response to land use.</p>                                Conclusions                 <p>Our results caution against assuming models or indicators derived from above-ground data can apply to soil assemblages and highlight the potential value of incorporating soil properties into biodiversity models.</p>", "keywords": ["Land-use intensity", "0106 biological sciences", "570", "Evolution", "[SDV]Life Sciences [q-bio]", "Organism abundance", "soil biodiversity", "01 natural sciences", "soil biota", "mixed-effects models", "Soil", "land\u2011use intensity", "Land-use", " Land-use intensity", " Mixed-effects models", " Organism abundance", " Soil biodiversity", " Soil biota", "land-use", "QH359-425", "Soil biota", "land-use intensity", "Biology", "Land-use", "QH540-549.5", "Ecosystem", "Soil Microbiology", "2. Zero hunger", "Ecology", "Research", "Biology and Life Sciences", "Biodiversity", "04 agricultural and veterinary sciences", "15. Life on land", "organism abundance", "Soil biodiversity", "Biota", "ddc:", "[SDV] Life Sciences [q-bio]", "Chemistry", "land\u2011use", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Human medicine", "Mixed-effects models", "mixed\u2011effects models"]}, "links": [{"href": "https://www.iris.unict.it/bitstream/20.500.11769/647835/1/12862_2022_Article_2089.pdf"}, {"href": "https://link.springer.com/content/pdf/10.1186/s12862-022-02089-4.pdf"}, {"href": "https://doi.org/10044/1/101414"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/BMC%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10044/1/101414", "name": "item", "description": "10044/1/101414", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10044/1/101414"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-17T00:00:00Z"}}, {"id": "20.500.14243/469825", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-24T16:26:26Z", "type": "Journal Article", "created": "2024-03-14", "title": "Participatory soil citizen science: An unexploited resource for European soil research", "description": "Abstract                   <p>Soils are key components of our ecosystems and provide 95%\uffe2\uff80\uff9399% of our food. This importance is reflected by an increase in participatory citizen science projects on soils. Citizen science is a participatory research method that actively involves and engages the public in scientific enquiry to generate new knowledge or understanding. Here, we review past and current citizen science projects on agricultural soils across Europe. We conducted a web\uffe2\uff80\uff90based survey and described 24 reviewed European citizen science projects in the light of the 10 principles of citizen science and identified success factors for citizen science. Over 66% of the projects generated soil biodiversity data; 54% and 42% of the projects generated data on vegetation cover and soil organic carbon, respectively. Our findings show that soil citizen science projects aligned with the 10 principles of citizen science offer an unexploited resource for European soil health research. We conclude that promoting co\uffe2\uff80\uff90creation, fostering knowledge\uffe2\uff80\uff90sharing networks and enabling long\uffe2\uff80\uff90term communication and commitment with citizens are success factors for further development of citizen science on soils.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "570", "web-based survey", "soil health", "soil biodiversity", "[SDV.SA.SDS]Life Sciences [q-bio]/Agricultural sciences/Soil study", "15. Life on land", "01 natural sciences", "333", "12. Responsible consumption", "03 medical and health sciences", "13. Climate action", "EJPSOIL", "EJPSOIL", " European agroecosystems", " participatory research", " soil biodiversity", " soil health", " web-based survey", "11. Sustainability", "European agroecosystems", "participatory research", "[SDV.SA.SDS] Life Sciences [q-bio]/Agricultural sciences/Soil study", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://iris.cnr.it/bitstream/20.500.14243/469825/1/2024_European%20J%20Soil%20Scienc_Mason.pdf"}, {"href": "https://doi.org/20.500.14243/469825"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "20.500.14243/469825", "name": "item", "description": "20.500.14243/469825", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/20.500.14243/469825"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-03-01T00:00:00Z"}}, {"id": "Biol\u00f3giai-talaj\u00e1llapot", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[16.2, 45.76], [16.2, 48.62], [22.71, 48.62], [22.71, 45.76], [16.2, 45.76]]]}, "properties": {"themes": [{"concepts": [{"id": "geoscientificInformation"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "National"}], "scheme": "https://inspire.ec.europa.eu/metadata-codelist/SpatialScope"}, {"concepts": [{"id": "MensMeu"}], "scheme": "Source"}, {"concepts": [{"id": "Hungary"}], "scheme": "http://publications.europa.eu/resource/authority/country"}, {"concepts": [{"id": "decline soil biodiversity"}], "scheme": "http://aims.fao.org/aos/agrovoc/c_330883"}], "updated": "2012-01-01", "type": "Dataset", "created": "01-01-2012", "language": "hun", "title": "Biological soil status", "description": "Soil biological status:", "formats": [{"name": "text/html"}, {"name": "canonical"}], "keywords": ["soil type", "basic soil properties", "National", "MensMeu", "Hungary", "decline soil biodiversity"], "contacts": [{"name": "L\u00e1szl\u00f3 P\u00e1sztor", "organization": "Institute for Soil Sciences,", "position": null, "roles": ["pointOfContact"], "phones": [{"value": null}], "emails": [{"value": "pasztor@rissac.hu"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": "Hungary"}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": null, "name_url": "", "description": null, "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}]}, "links": [{"href": "http://okir-tdr.helion.hu/?talajallapot=1", "name": "HTML", "protocol": "text/html", "rel": null}, {"href": "https://github.com/ejpsoil/ejpsoildatahub/tree/main/datasets/mensmeu/Hungary/Biologiai-talajallapot.yml", "name": "Source of the record", "protocol": "canonical", "rel": "canonical"}, {"rel": "self", "type": "application/geo+json", "title": "Biol\u00f3giai-talaj\u00e1llapot", "name": "item", "description": "Biol\u00f3giai-talaj\u00e1llapot", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biol\u00f3giai-talaj\u00e1llapot"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2012-01-01T00:00:00Z"}}, {"id": "Soil-and-Earthworm-Survey", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[-7.57, 49.96], [-7.57, 58.64], [1.68, 58.64], [1.68, 49.96], [-7.57, 49.96]]]}, "properties": {"themes": [{"concepts": [{"id": "geoscientificInformation"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "National"}], "scheme": "https://inspire.ec.europa.eu/metadata-codelist/SpatialScope"}, {"concepts": [{"id": "MensMeu"}], "scheme": "Source"}, {"concepts": [{"id": "UK"}], "scheme": "http://publications.europa.eu/resource/authority/country"}, {"concepts": [{"id": "decline soil biodiversity"}], "scheme": "http://aims.fao.org/aos/agrovoc/c_330883"}], "license": "registration needed", "updated": "2010-01-01", "type": "Dataset", "created": "2010-01-01", "language": "eng", "title": "Soil and Earthworm Survey", "description": "The OPAL (Open Air Laboratories) Data Explorer allows you to visualise environmental data", "formats": [{"name": "text/html"}, {"name": "canonical"}], "keywords": ["soil degradation processes", "National", "MensMeu", "UK", "decline soil biodiversity"], "contacts": [{"name": null, "organization": "Imperial College London", "position": null, "roles": ["pointOfContact"], "phones": [{"value": null}], "emails": [{"value": "opal@imperial.ac.uk )"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": "UK"}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": null, "name_url": "", "description": null, "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}]}, "links": [{"href": "https://www.opalexplorenature.org/dataexplorer/surveytype/soilsurvey", "name": "HTML", "protocol": "text/html", "rel": null}, {"href": "https://github.com/ejpsoil/ejpsoildatahub/tree/main/datasets/mensmeu/UK/Soil-and-Earthworm-Survey.yml", "name": "Source of the record", "protocol": "canonical", "rel": "canonical"}, {"rel": "self", "type": "application/geo+json", "title": "Soil-and-Earthworm-Survey", "name": "item", "description": "Soil-and-Earthworm-Survey", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil-and-Earthworm-Survey"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-01-01T00:00:00Z"}}, {"id": "6ab178db-0ae7-4220-8408-7462eceacd2c", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[11.0, 52.0], [11.0, 54.0], [11.0, 54.0], [11.0, 52.0], [11.0, 52.0]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "soil organisms"}, {"id": "tillage"}, {"id": "tillage equipment"}, {"id": "cultivation equipment"}, {"id": "intensification"}, {"id": "anthropogenic factors"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "mouldboard ploughing"}, {"id": "intensive cultivation soil biodiversity"}, {"id": "impacts on soil fauna"}, {"id": "anthropogenic effects"}, {"id": "agricultural intensification."}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agricultural management"}, {"id": "cultivation method"}, {"id": "cultivation of agricultural land"}, {"id": "cultivation system"}, {"id": "soil biodiversity"}, {"id": "intensive farming"}], "scheme": "GEMET - Concepts, version 2.4"}, {"concepts": [{"id": "agricultural management"}, {"id": "cultivation method"}, {"id": "cultivation of agricultural land"}, {"id": "cultivation system"}, {"id": "soil biodiversity"}, {"id": "intensive farming"}], "scheme": "INSPIRE"}], "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Centre's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Centre and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Centre and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Centre and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2022-11-18", "type": "Dataset", "created": "2022-11-08", "language": "eng", "title": "Database for meta-analysis: Reducing tillage intensity benefits the soil micro- and mesofauna in a global meta-analysis.", "description": "This dataset includes data extracted from published studies reporting results on the effects of different tillage intensities on soil fauna. The literature was systematically reviewed in compliance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis framework (\u201cPRISMA\u201d). Peer-reviewed publications were searched using the Web of Science search engine, including all available databases with the following search terms: \u201cTOPIC: (tillage OR plough* OR chisel* OR till* OR mouldboard* OR disc* OR tine* OR rotatory OR rotary OR harrow* ) AND (fauna* OR biota* OR organism* OR mesofauna* OR acari OR mite* OR enchytraeid* OR nematod* OR springtail* OR collembola*)\u201c. The resulting database covers 3459 observations from 133 publications published between 1981 and 2020.\n\nResearch domain: Ecology of Agricultural Landscapes\n\nResearch question: (1) What is the effect of reducing tillage intensity on density and diversity of soil micro- and mesofaunal communities?\n(2) What are the main pedoclimatic conditions and concurrent management practices that drive the effects of reducing tillage intensity on soil fauna i.e., fertilization regimes, soil-related (pH, organic matter, texture) and climatic factors?", "formats": [{"name": "CSV"}], "keywords": ["Soil", "soil organisms", "tillage", "tillage equipment", "cultivation equipment", "intensification", "anthropogenic factors", "opendata", "mouldboard ploughing", "intensive cultivation soil biodiversity", "impacts on soil fauna", "anthropogenic effects", "agricultural intensification.", "Boden", "agricultural management", "cultivation method", "cultivation of agricultural land", "cultivation system", "soil biodiversity", "intensive farming", "agricultural management", "cultivation method", "cultivation of agricultural land", "cultivation system", "soil biodiversity", "intensive farming"], "contacts": [{"name": "Bibiana Betancur-Corredor", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "bibiana.betancurcorredor@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "0000-0003-1942-4527", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "David J. Russell", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "david.russell@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "0000-0002-7514-4573", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": null, "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Birgit Lang", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "birgit.lang@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "0000-0002-7514-4573", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=6ab178db-0ae7-4220-8408-7462eceacd2c", "rel": "download"}, {"rel": "self", "type": "application/geo+json", "title": "6ab178db-0ae7-4220-8408-7462eceacd2c", "name": "item", "description": "6ab178db-0ae7-4220-8408-7462eceacd2c", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/6ab178db-0ae7-4220-8408-7462eceacd2c"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-18T00:00:00Z"}}, {"id": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[6.16, 50.16], [6.16, 51.32], [7.61, 51.32], [7.61, 50.16], [6.16, 50.16]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "GEMET - Concepts, version 2.4"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Inplamint's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Inplamint and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-04-15", "type": "Dataset", "created": "2023-01-24", "language": "eng", "title": "Soil fungal community across a 52-year chronosequence of soil recultivation after open-mining in Inden, Germany", "description": "The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6\u00b015\u20190\u2019 E to 6\u00b021\u20190\u2019 E and 50\u00b050\u20195\u2019 N to 50\u00b053\u20190\u2019 N) of an open-cast lignite mine at Inden, between Cologne, Aachen, M\u00f6nchengladbach, and D\u00fcsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years, at samling time of 2016. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha\u22121 a\u22121 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). They are a total of 115 samples (5 replicates per field x 2 seasons, each field corresponds to a year of recultivation). Four samples were removed due to failed PCR. The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5\u2032\u2010GTGARTCATCGAATCTTTG\u20103\u2032 / ITS4: 5\u2032\u2010TCCTCCGCTTATTGATATGC\u20103\u2032). Amplicon sequence variants (ASVs) were inferred using DADA2 in R. Taxonomic annotations were performed using the IDTaxa algorithm implemented in the DECIPHER R package, against UNITE (version of 10.05.2021). Raw sequencing reads are available at ENA under study project PRJEB51095. The DNA sequences of the fungal amplicon sequence variants are available at ENA under accession numbers OV986018-OV989728. The processed dataset including the ASV count table, ASV taxonomy, and sample metadata compiled as a phyloseq R object stored in a single .RDS R file, as well as ASV guild annotation using Funguild database, are available at figshare at (https://doi.org/10.6084/m9.figshare.20160578). To read the data in the software R, use readRDS() function). Here we upload at the BONARES data centre the relative abundance of each fungal guild (% of DNA sequences) per samples along with basic metadata for easy reuse. The guild name and metadata name is provided in the header of each column. The entire set of measured soil physico-chemical parameters has been deposited at BONARES under reference 72ca6e98-5aab-4884-bf1b-56931482eb94. The publication associated to the dataset can be found at https://doi.org/10.1007/s00248-022-02058-w. Roy J, Reichel R, Br\u00fcggemann N, Rillig MC. 2022. Functional, not Taxonomic, Composition of Soil Fungi Reestablishes to Pre   mining Initial State After 52 Years of Recultivation. Microbial Ecology. Other publications associated to the datasets are : (1) Reichel R., H\u00e4nsch M., Br\u00fcggemann N. (2017). Indication of rapid soil food web recovery by nematode-derived indices in restored agricultural soil after open-cast lignite mining. Soil Biology and Biochemistry, 115, 261-264. DOI: 10.1016/j.soilbio.2017.08.020; (2) Roy J., Reichel R., Br\u00fcggemann N., Hempel S., Rillig M. (2017). Succession of arbuscular mycorrhizal fungi along a 52-years agricultural recultivation chronosequence. FEMS Microbiology Ecology. DOI: 1093/femsec/fix102", "formats": [{"name": "CSV"}], "keywords": ["Soil", "agriculture", "microbiology", "opendata", "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic", "Boden", "agriculture", "microbiology"], "contacts": [{"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "BonaRes Data Center", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Matthias Rillig", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "rrillig@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3541-7853", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Forschungszentrum J\u00fclich GmbH;Freie Universit\u00e4t Berlin", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4cf3c473-96a6-4660-b973-30c0f03c7cd2", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure1.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure2.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure3.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "name": "item", "description": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4cf3c473-96a6-4660-b973-30c0f03c7cd2"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-04-15T00:00:00Z"}}], "links": [{"rel": "self", "type": "application/geo+json", "title": "This document as GeoJSON", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=+soil+biodiversity&f=json", "hreflang": "en-US"}, {"rel": "alternate", "type": "text/html", "title": "This document as HTML", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=+soil+biodiversity&f=html", "hreflang": "en-US"}, {"rel": "collection", "type": "application/json", "title": "Collection URL", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main", "hreflang": "en-US"}, {"type": "application/geo+json", "rel": "first", "title": "items (first)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=+soil+biodiversity&", "hreflang": "en-US"}, {"rel": "last", "type": "application/geo+json", "title": "items (last)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=+soil+biodiversity&offset=11", "hreflang": "en-US"}], "numberMatched": 11, "numberReturned": 11, "distributedFeatures": [], "timeStamp": "2026-06-25T05:25:52.386646Z"}