{"type": "FeatureCollection", "features": [{"id": "10.7910/DVN/GVNJAB", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:45Z", "type": "Dataset", "created": "2019-06-24", "title": "Physical topsoil  properties in Murugusi, Western Kenya", "description": "Open Access&lt;b&gt;General:&lt;/b&gt; Lab determined topsoil bulk density, contents of sand, clay and organic carbon in Murugusi, W. Kenya, together with spatial coordinates of where the soil samples were taken (rounded to the closest center point of a 250 m \u00d7 250 m raster). All lab analyses were carried out at the ILRI/CIAT lab in Nairob, Kenya.  &lt;br&gt;  &lt;b&gt;Soil sampling:&lt;/b&gt; At each sample location, one composite topsoil sample was taken; three cores of 7 cm in diameter taken within an area of one square meter. The soil was taken from 0-0.2 m depth below any organic (O) horizon.   &lt;br&gt;  &lt;b&gt;Determination of soil properties:&lt;/b&gt; The bulk density of the soil was determined by taking two undisturbed soil samples (0-10 cm and 10-20 cm depth) of known volume (100 cm2) and weighting them after air drying. Soil fractions of clay (&lt;0.002 mm) and sand (0.05-2 mm) were determined by the hydrometer method (Estefan et al., 2014), using 10% sodium hexametaphosphate as the dispersing agent. Soil pH was determined potentiometrically on a soil suspension of 1:2 (soil: water). Total carbon was measured after dry combustion using an elemental analyser (Elementar Vario max cube; ISO 10694, first edition 1995-03-01)  &lt;br&gt;  &lt;b&gt;Reference: &lt;/b&gt;Estefan G., Sommer R., Ryan J. (2014) Analytical Methods for Soil-Plant and Water in Dry Areas. A Manual of Relevance to the West Asia and North Africa Region. 3rd Edition, International Center for Agricultural Research in the Dry Areas, Aleppo, 255 pp. Available online at: http://repo.mel.cgiar.org:8080/handle/20.500.11766/7512?show=full. Verified: October 9, 2018.  &lt;br&gt;  &lt;b&gt;Acknowledgements: &lt;/b&gt; We are deeply thankful for the good services provided by John Mukulama (soil sampling), John Yumbya Mutua (soil sampling) and Francis Mungthu Njenga (lab analyses) The project was carried out within the CGIAR Research Program on Water, Land and Ecosystems (WLE).", "keywords": ["Soil organic matter", "Agricultural Sciences", "Soil organic carbon", "sand", "Kenya", "Carbon", "Latin America and the Caribbean", "soil", "Soil", "Soil bulk density", "Sand", "soil organic matter", "Earth and Environmental Sciences", "Soil texture", "Murugusi", "Africa", "Clay", "Texture", "Western Kenya", "Agroecosystems and Sustainable Landscapes - ASL"], "contacts": [{"organization": "Piikki, Kristin, S\u00f6derstr\u00f6m, Mats, Sommer, Rolf, Da Silva, Mayesse,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.7910/DVN/GVNJAB"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/GVNJAB", "name": "item", "description": "10.7910/DVN/GVNJAB", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/GVNJAB"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-01-01T00:00:00Z"}}, {"id": "10.7910/DVN/ZTMDUR", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:47Z", "type": "Dataset", "created": "2005-01-01", "title": "Pilot Analysis of Global Ecosystems (PAGE), Agroecosystems dataset", "description": "&lt;br&gt;The Pilot Analysis of Global Ecosystems (PAGE): Agroecosystems was one of four pilot studies undertaken as precursors to the Millennium Ecosystem Assessment. The study identifies linkages between crop production systems and environmental services such as food, soil resources, water, biodiversity, and carbon cycling, in the hopes that a better understanding of these linkages might lead to policies that can contribute both to improved food output and to improved ecosystem service provision. Th e PAGE Agroecosystems report includes a series of 24 maps that provide a detailed spatial perspective on agroecosystems a nd agroecosystem services. Pilot Analysis of Global Ecosystems (PAGE): Agroecosystems Dataset offers the 9 geospatial datasets used to build these maps. &lt;/br&gt;  &lt;br&gt;The datasets are:&lt;/br&gt;  &lt;br&gt;PAGE Global Agricultural Extent. The data describe the location and extent of global agriculture and are derived from GLLCCD 1998; USGS EDC1999a.&lt;/br&gt;  &lt;br&gt;PAGE Global Agricultural Extent version 2. The data are an update of the original PAGE Global Agricultural Extent, based on version 2 of the Global Land Cover Characteristics Dataset (GLCCD v2.0, USGS/EDC 2000). The methods used to create this dataset were the same as those employed to create the origina l PAGE Global Agricultural Extent.&lt;/br&gt;  &lt;br&gt;Mask of the Global Extent of Agriculture. This dataset displays the global extent of agricultural areas as defined by the PAGE study. The other datasets made available on this site (eg. tree cover, soil carbon, area free of soil constraints) only show values for areas within this agricultural extent.&lt;/br&gt;  &lt;br&gt;PAGE Global Agroecosystems. These data characterize agroecosystems, defined as 'a biological and natural resource system managed by humans for the primary purpose of producing food as well as other socially valuable nonfood products and environmental services.' &lt;/br&gt;  &lt;br&gt;Percentage Tree Cover within the Extent of Agriculture. This is a raster dataset that shows the proportion of land area within the PAGE agricultural extent that is occupied by 'woody vegetation' (mature vegetation whose approximate height is greater than 5 meters).&lt;/br&gt;  &lt;br&gt;Carbon Storage in Soils within the PAGE Agricultural Extent. The data give a global estimate of soil organic carbon storage in agricultural lands, calculated by applying Batjes' (1996 and 2000) soil organic carbon content values by soil type area share of each 5 x 5 minute of the Digital Soil Map of the World (FAO 1995). &lt;/br&gt;  &lt;br&gt;Agriculture Share of Watershed. This dataset depicts agricultural area as a share of total watershed area. The share of each watershed that is agricultural was calculated by applying a weighted percentage to each PAGE agricultural land cover class.&lt;/br&gt;  &lt;br&gt;Area Free of Soil Constraints. The data show the proportional area within the PAGE agricultural extent that is free from soil constraints. The area free of soil constraints is based on fertility capability classification (FCC) app lied to FAO's Digital Soil Map of the World (1995).&lt;/br&gt;  &lt;br&gt;Outline of Land and Water Area. These data are used to provide a boundary for land areas and facilitate the readability of maps.&lt;/br&gt;", "keywords": ["Pilot Analysis of Global Ecosystems (PAGE)", "Agroecosystems"], "contacts": [{"organization": "Wood, Stanley, Sebastian, Kate, Scherr, Sara,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.7910/DVN/ZTMDUR"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/ZTMDUR", "name": "item", "description": "10.7910/DVN/ZTMDUR", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/ZTMDUR"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2005-01-01T00:00:00Z"}}, {"id": "10.1016/j.catena.2019.104352", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:16:03Z", "type": "Journal Article", "created": "2019-12-02", "title": "Long-term effectiveness of sustainable land management practices to control runoff, soil erosion, and nutrient loss and the role of rainfall intensity in Mediterranean rainfed agroecosystems", "description": "Mediterranean environments are especially susceptible to soil erosion and to inappropriate soil management, leading to accelerated soil loss. Sustainable Land Management (SLM) practices (such as reduced tillage, no-tillage, cover crops, etc.,) have the potential to reduce soil, organic carbon (OC), and nutrient losses by erosion. However, the effectivity of these practices is site-dependent and varies under different rainfall conditions. The objective of this paper was to evaluate the effects of SLM practices   in two rainfed systems (a wheat field and an almond orchard) representative of a large area of the driest Mediterranean regions - on runoff, soil erosion, particle size distribution, and OC and nutrient (N and P) contents in sediments. The influence of the rainfall characteristics on the effectiveness of the SLM practices was also evaluated. The SLM implemented were: reduced tillage (RT) in the wheat field and almond orchard and reduced tillage combined with green manure (RTG) in the almond orchard; these were compared to conventional tillage, the usual practice in the area. Open erosion plots were set up to monitor the effects of SLM on soil carbon and nutrients and on soil erosion after each rainfall event over six years (2010 2016). The results show that the SLM practices evaluated resulted in increased organic carbon (OC) and nutrients (N and P) contents in the soil, and reduced runoff, erosion, and mobilization of organic carbon and nutrients in sediments. Reductions in runoff of 30% and 65% and decreases in erosion of 65 and 85% were found in the wheat field and almond orchards, respectively. In addition, the total OC, N, and P losses in the wheat field were reduced by 56%, 45%, and 64%, respectively, while in the almond field the OC, N, and P losses were reduced by 90% under RT and by 85% under RTG. The beneficial effect of the SLM practices on soil erosion was observed within 18 months of their implementation and continued throughout the six years of the study. Furthermore, the effectiveness of tillage reduction with respect to erosion control and carbon and nutrients mobilization was highest during the most intense rainfall events, which are responsible for the highest erosion rates in Mediterranean areas. Our results support the key role of SLM practices under semiarid conditions as useful tools for climate change mitigation and adaptation, given the expected increase in high-intensity rainfall events in semiarid areas. \u00a9 2019 The Authors This study site has been funded by several national (CYCIT AGL201125069//CICYT AGL2010-20941//CGL2013-42009-R//CGL2014-55-405-R), Regional (S\u00e9neca Foundation: 08757/PI/08//19350/PI/14), and European Commission H2020 (F6 DG RTD 037046 and Grant 728003, DIVERFARMING projects). Joris de Vente acknowledges support from a Ram\u00f3n y Cajal research grant (RYC-2012-10375) and Mar\u00eda Almagro was supported by the Juan de la Cierva Program (IJCI-2015-23500).", "keywords": ["2. Zero hunger", "Rainfed agroecosystems", "Green manure", "04 agricultural and veterinary sciences", "15. Life on land", "Soil fertility", "6. Clean water", "ddc:", "Tillage", "12. Responsible consumption", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Green manure | Organic carbon | Rainfed agroecosystems | Soil fertility | Tillage", "Organic carbon"]}, "links": [{"href": "https://doi.org/10.1016/j.catena.2019.104352"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/CATENA", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.catena.2019.104352", "name": "item", "description": "10.1016/j.catena.2019.104352", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.catena.2019.104352"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-04-01T00:00:00Z"}}, {"id": "10.1007/s10021-008-9154-z", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:14:44Z", "type": "Journal Article", "created": "2008-05-27", "title": "Reversibility Of Soil Productivity Decline With Organic Matter Of Differing Quality Along A Degradation Gradient", "description": "In the highlands of Western Kenya, we investigated the reversibility of soil productivity decline with increasing length of continuous maize cultivation over 100\u00a0years (corresponding to decreasing soil organic carbon (SOC) and nutrient contents) using organic matter additions of differing quality and stability as a function of soil texture and inorganic nitrogen (N) additions. The ability of additions of labile organic matter (green and animal manure) to improve productivity primarily by enhanced nutrient availability was contrasted with the ability of stable organic matter (biochar and sawdust) to improve productivity by enhancing SOC. Maize productivity declined by 66% during the first 35\u00a0years of continuous cropping after forest clearing. Productivity remained at a low level of 3.0\u00a0t\u00a0grain\u00a0ha-1 across the chronosequence stretching up to 105\u00a0years of continuous cultivation despite full N\u2013phosphorus (P)\u2013potassium (K) fertilization (120\u2013100\u2013100\u00a0kg ha\u22121). Application of organic resources reversed the productivity decline by increasing yields by 57\u2013167%, whereby responses to nutrient-rich green manure were 110% greater than those from nutrient-poor sawdust. Productivity at the most degraded sites (80\u2013105\u00a0years since forest clearing) increased in response to green manure to a greater extent than the yields at the least degraded sites (5\u00a0years since forest clearing), both with full N\u2013P\u2013K fertilization. Biochar additions at the most degraded sites doubled maize yield (equaling responses to green manure additions in some instances) that were not fully explained by nutrient availability, suggesting improvement of factors other than plant nutrition. There was no detectable influence of texture (soils with either 11\u201314 or 45\u201349% clay) when low quality organic matter was applied (sawdust, biochar), whereas productivity was 8, 15, and 39% greater (P\u00a0<\u00a00.05) on sandier than heavier textured soils with high quality organic matter (green and animal manure) or only inorganic nutrient additions, respectively. Across the entire degradation range, organic matter additions decreased the need for additional inorganic fertilizer N irrespective of the quality of the organic matter. For low quality organic resources (biochar and sawdust), crop yields were increasingly responsive to inorganic N fertilization with increasing soil degradation. On the other hand, fertilizer N additions did not improve soil productivity when high quality organic inputs were applied. Even with the tested full N\u2013P\u2013K fertilization, adding organic matter to soil was required for restoring soil productivity and most effective in the most degraded sites through both nutrient delivery (with green manure) and improvement of SOC (with biochar).", "keywords": ["Soil nutrients", "2. Zero hunger", "Soil management", "Soil organic matter", "Chronosequence", "Sustainable agriculture", "Green manure crops", "04 agricultural and veterinary sciences", "15. Life on land", "Soil fertility", "Soil degradation", "Soil productivity", "Soil erosion", "0401 agriculture", " forestry", " and fisheries", "Biochar addition", "Clay concentration", "Agroecosystems", "Field Scale"]}, "links": [{"href": "https://doi.org/10.1007/s10021-008-9154-z"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecosystems", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s10021-008-9154-z", "name": "item", "description": "10.1007/s10021-008-9154-z", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s10021-008-9154-z"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2008-05-28T00:00:00Z"}}, {"id": "10.1007/s42832-021-0077-3", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:15:28Z", "type": "Journal Article", "created": "2021-03-13", "title": "Research trends of microplastics in the soil environment: Comprehensive screening of effects", "description": "Abstract<p>We collated and synthesized previous studies that reported the impacts of microplastics on soil parameters. The data were classified and integrated to screen for the proportion of significant effects, then we suggest several directions to alleviate the current data limitation in future experiments. We compiled 106 datasets capturing significant effects, which were analyzed in detail. We found that polyethylene and pellets (or powders) were the most frequently used microplastic composition and shape for soil experiments. The significant effects mainly occurred in broad size ranges (0.1\uffe2\uff80\uff931 mm) at test concentrations of 0.1%\uffe2\uff80\uff9310% based on soil dry weight. Polyvinyl chloride and film induced significant effects at lower concentrations compared to other compositions and shapes, respectively. We adopted a species sensitivity distribution (SSD) and soil property effect distribution (SPED) method using available data from soil biota, and for soil properties and enzymes deemed relevant for microplastic management. The predicted-no-effect-concentration (PNEC)-like values needed to protect 95% of soil biota and soil properties was estimated to be between 520 and 655 mg kg\uffe2\uff88\uff921. This study was the first to screen microplastic levels with a view toward protecting the soil system. Our results should be regularly updated (e.g., quarterly) with additional data as they become available.</p>", "keywords": ["Significant effect", "2. Zero hunger", "570", "Soil", "Species sensitivity distribution", "0211 other engineering and technologies", "Soil ; Significant effect ; Soil properties ; Microplastics in agroecosystems ; Species sensitivity distribution ; Research Article", "Soil properties", "500 Naturwissenschaften und Mathematik::570 Biowissenschaften; Biologie::570 Biowissenschaften; Biologie", "02 engineering and technology", "15. Life on land", "01 natural sciences", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://link.springer.com/content/pdf/10.1007/s42832-021-0077-3.pdf"}, {"href": "https://doi.org/10.1007/s42832-021-0077-3"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Ecology%20Letters", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s42832-021-0077-3", "name": "item", "description": "10.1007/s42832-021-0077-3", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s42832-021-0077-3"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-03-13T00:00:00Z"}}, {"id": "10.1007/s13593-014-0215-8", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:15:26Z", "type": "Journal Article", "created": "2014-04-07", "title": "Fourteen Years Of Evidence For Positive Effects Of Conservation Agriculture And Organic Farming On Soil Life", "description": "Conventional agriculture strongly alters soil quality due to industrial practices that often have negative effects on soil life. Alternative systems such as conservation agriculture and organic farming could restore better conditions for soil organisms. Improving soil life should in turn improve soil quality and farming sustainability. Here, we have compared for the first time the long-term effects of conservation agriculture, organic farming, and conventional agriculture on major soil organisms such as microbes, nematofauna, and macrofauna. We have also analyzed functional groups. Soils were sampled at the 14-year-old experimental site of La Cage, near Versailles, France. The microbial community was analyzed using molecular biology techniques. Nematofauna and macrofauna were analyzed and classified into functional groups. Our results show that both conservation and organic systems increased the abundance and biomass of all soil organisms, except predaceous nematodes. For example, macrofauna increased from 100 to 2,500 %, nematodes from 100 to 700 %, and microorganisms from 30 to 70 %. Conservation agriculture showed a higher overall improvement than organic farming. Conservation agriculture increased the number of many organisms such as bacteria, fungi, anecic earthworms, and phytophagous and rhizophagous arthropods. Organic farming improved mainly the bacterial pathway of the soil food web and endogeic and anecic earthworms. Overall, our study shows that long-term, no-tillage, and cover crops are better for soil biota than periodic legume green manures, pesticides, and mineral fertilizers.", "keywords": ["570", "biodiversit\u00e9 du sol", "[SDV]Life Sciences [q-bio]", "630", "Soil quality", "n\u00e9matofaune", "microorganisme du sol", "agriculture biologique", "Soil food web", "Land management", "11. Sustainability", "Agricultural sustainability", "Soil biodiversity;Functional groups;Soil food web;Soil functionning;Soil quality;Land management;Agricultural sustainability;Agroecosystems;Agroecology", "Agroecosystems", "Soil functioning", "2. Zero hunger", "communaut\u00e9 microbienne", "Soil functionning", "agriculture conventionnelle", "04 agricultural and veterinary sciences", "Agro\u00e9cologie", "15. Life on land", "Soil biodiversity", "6. Clean water", "[SDV] Life Sciences [q-bio]", "13. Climate action", "Functional groups", "agriculture de conservation", "0401 agriculture", " forestry", " and fisheries", "Agroecology"]}, "links": [{"href": "https://doi.org/10.1007/s13593-014-0215-8"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Agronomy%20for%20Sustainable%20Development", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s13593-014-0215-8", "name": "item", "description": "10.1007/s13593-014-0215-8", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s13593-014-0215-8"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2014-04-08T00:00:00Z"}}, {"id": "10.1016/j.agee.2009.07.001", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:15:34Z", "type": "Journal Article", "created": "2009-07-31", "title": "Tillage And Cropping Effects On Soil Organic Carbon In Mediterranean Semiarid Agroecosystems: Testing The Century Model", "description": "Open AccessPeer reviewed", "keywords": ["2. Zero hunger", "Soil organic carbon", "13. Climate action", "Dryland agroecosystems", "0401 agriculture", " forestry", " and fisheries", "Semiarid Spain", "04 agricultural and veterinary sciences", "15. Life on land", "Simulation modeling", "Tillage"]}, "links": [{"href": "https://doi.org/10.1016/j.agee.2009.07.001"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Agriculture%2C%20Ecosystems%20%26amp%3B%20Environment", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.agee.2009.07.001", "name": "item", "description": "10.1016/j.agee.2009.07.001", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.agee.2009.07.001"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2009-12-01T00:00:00Z"}}, {"id": "10.1016/j.apsoil.2005.03.003", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:15:49Z", "type": "Journal Article", "created": "2005-04-20", "title": "Effects Of Organic Versus Conventional Management On Chemical And Biological Parameters In Agricultural Soils", "description": "Abstract   A comparative study of organic and conventional arable farming systems was conducted in The Netherlands to determine the effect of management practices on chemical and biological soil properties and soil health. Soils from thirteen accredited organic farms and conventionally managed neighboring farms were analyzed using a polyphasic approach combining traditional soil analysis, culture-dependent and independent microbiological analyses, a nematode community analysis and an enquiry about different management practices among the farmers. Organic management, known primarily for the abstinence of artificial fertilizers and pesticides, resulted in significantly lower levels of both nitrate and total soluble nitrogen in the soil, higher numbers of bacteria of different trophic groups, as well as larger species richness in both bacteria and nematode communities and more resilience to a drying\u2013rewetting disturbance in the soil. The organic farmers plough their fields less deeply and tend to apply more organic carbon to their fields, but this did not result in a significantly higher organic carbon content in their soils. The levels of ammonium, organic nitrogen, phosphate and total phosphorus did not differ, significantly between the soils under different management. Fifty percent of the conventional Dutch farmers also used organic fertilizers and the numbers of farmers using a green crop fertilizer did not differ between the two management types. Soil type \u2013 clayey or sandy soil \u2013 in general had a much stronger effect on the soil characteristics than management type. The soil type influenced pH, nitrate, ammonium, phosphate and organic carbon levels as well as numbers of oligotrophic bacteria and of different groups of nematodes, and different diversity indices. With the collected data set certain soil characteristics could also be attributed to the use of different management practices like plow depth, crop or cover crop type or to the management history of the soil.", "keywords": ["0106 biological sciences", "2. Zero hunger", "agroecosystems", "microbial-populations", "species composition", "plant", "04 agricultural and veterinary sciences", "15. Life on land", "maturity index", "01 natural sciences", "6. Clean water", "diversity", "communities", "gradient gel-electrophoresis", "low-input", "0401 agriculture", " forestry", " and fisheries", "farming systems"], "contacts": [{"organization": "van Diepeningen, A.D., de Vos, O.J., Korthals, G.W., van Bruggen, A.H.C.,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1016/j.apsoil.2005.03.003"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Applied%20Soil%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.apsoil.2005.03.003", "name": "item", "description": "10.1016/j.apsoil.2005.03.003", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.apsoil.2005.03.003"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2006-01-01T00:00:00Z"}}, {"id": "10.1016/j.geoderma.2008.04.005", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:16:38Z", "type": "Journal Article", "created": "2008-05-30", "title": "Tillage And Cropping Intensification Effects On Soil Aggregation: Temporal Dynamics And Controlling Factors Under Semiarid Conditions", "description": "Open AccessPeer reviewed", "keywords": ["2. Zero hunger", "Water aggregate stability", "Semiarid agroecosystems", "0401 agriculture", " forestry", " and fisheries", "04 agricultural and veterinary sciences", "15. Life on land", "Mean weight diameter", "6. Clean water", "Tillage"]}, "links": [{"href": "https://doi.org/10.1016/j.geoderma.2008.04.005"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Geoderma", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.geoderma.2008.04.005", "name": "item", "description": "10.1016/j.geoderma.2008.04.005", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.geoderma.2008.04.005"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2008-06-01T00:00:00Z"}}, {"id": "10.1016/j.pedobi.2010.03.002", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:16:59Z", "type": "Journal Article", "created": "2010-04-05", "title": "Earthworm Impacts On Soil Organic Matter And Fertilizer Dynamics In Tropical Hillside Agroecosystems Of Honduras", "description": "Abstract   Earthworms are important processors of soil organic matter (SOM) and nutrient turnover in terrestrial ecosystems. In agroecosystems, they are often seen as beneficial organisms to crop growth and are actively promoted by farmers and extension agents, yet their contribution to agroecosystem services is uncertain and depends largely on management. The Quesungual slash-and-mulch agroforestry system (QSMAS) of western Honduras has been proposed as a viable alternative to traditional slash-and-burn (SB) practices and has been shown to increase earthworm populations, yet the effect of earthworms on soil fertility and SOM in QSMAS is poorly understood. This study examined the role of Pontoscolex corethrurus in QSMAS by comparing their influence on aggregate-associated SOM and fertilizer dynamics with their effects under SB and secondary forest in a replicated field trial. Both the fertilized QSMAS and SB treatments had plots receiving additions of inorganic 15N and P, as well as plots with no inorganic N additions. Earthworm populations were manipulated in field microcosms at the beginning of the rainy season within each management treatment via additions of P. corethrurus or complete removal of existing earthworm populations. Microcosms were destructively sampled at harvest of Zea mays and soils were wet-sieved (using 53, 250 and 2000\u00a0\u03bcm mesh sizes) to isolate different aggregate size fractions, which were analyzed for total C, N and 15N. The effects of management system were smaller than expected, likely due to disturbance associated with the microcosm installation. Contrary to our hypothesis that earthworms would stabilize organic matter in soil aggregates, P. corethrurus decreased total soil C by 3% in the surface layer (0\u201315\u00a0cm), predominantly through a decrease in the C concentration of macroaggregates (>250\u00a0\u03bcm) and a corresponding depletion of C in coarse particulate organic matter occluded within macroaggregates. Earthworms also decreased bulk density by over 4%, but had no effect on aggregate size distribution. Within the two fertilized treatments, the QSMAS appeared to retain slightly more fertilizer derived N in smaller aggregate fractions (", "keywords": ["2. Zero hunger", "agroecosystems", "materia organica del suelo", "aplicacion de abonos", "04 agricultural and veterinary sciences", "15. Life on land", "nitrogen", "6. Clean water", "oligochaeta", "fertilization", "soil organic matter", "agroecosistemas", "0401 agriculture", " forestry", " and fisheries", "honduras"]}, "links": [{"href": "https://doi.org/10.1016/j.pedobi.2010.03.002"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Pedobiologia", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.pedobi.2010.03.002", "name": "item", "description": "10.1016/j.pedobi.2010.03.002", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.pedobi.2010.03.002"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-08-01T00:00:00Z"}}, {"id": "10.1016/j.scitotenv.2025.178646", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:17:11Z", "type": "Journal Article", "created": "2025-02-04", "title": "Assessing and mapping changes in soil ecosystem services and soil threats in agroecosystems through scenario-based approaches \u2013 A systematic review", "description": "Scenario analysis plays a central role in estimating how global changes affect the relationships linking ecosystem conditions and functioning to human needs. This is particularly true for agroecosystems, which are pivotal to ensure sustainable land planning, ecological management and food security strategies. Soils are key providers of multiple ecosystem services (ES) in agroecosystems but they are very sensitive to global drivers such as changes in climate, land use and cover. How agroecosystems should achieve sustainability, through optimizing soil capacity to supply ES while limiting the occurrence of threats, is a priority of EU policy agendas. Nevertheless, there is currently a lack of a comprehensive framework of scenario-based approaches to assess changes in soil ES (SES) and soil threats (ST). As a part of the project SERENA funded by the European Joint Program on Agricultural Soil Management, this study aims to: i) understand how drivers of global change are commonly studied in the scientific literature; ii) identify how some SES and ST are assessed in scenario-based approaches; iii) provide a preliminary discussion on how soil properties are represented in these approaches. Through a systematic review of 230 published articles related to seven SES and ten ST, this study highlights that not all SES and ST are considered with the same frequency and geographic distribution in scenario-based approaches. Despite a great methodological variability in the assessment and mapping of SES and ST, dominant methodological trends can be identified. SES are mapped more frequently than ST and, specific SES appear more disposed to spatially explicit assessments than others. Due to its novelty and complexity, research on this topic is limited to a small subset of ST or SES and projections of the combined impacts of climate, land use and management changes on multiple ST and SES should be a scientific priority to help policy makers.", "keywords": ["Conservation of Natural Resources", "550", "Scenario-based", "[SDE.MCG]Environmental Sciences/Global Changes", "Climate Change", "Agriculture", "333", "Soil ecosystem services", "Soil ecosystem services", " Soil threats", " Indicators", " Scenario-based", " Agroecosystems", "Soil", "[SDE]Environmental Sciences", "Soil threats", "Indicators", "Agroecosystems", "Ecosystem", "Environmental Monitoring"], "contacts": [{"organization": "Scammacca, Ottone, Montagne, David, Asins-Velis, Sabina, Bondi, Giulia, Boru\u030avka, Lubos\u030c, Buttafuoco, Gabriele, Cadero, Alice, Calzolari, Costanza, Cousin, Isabelle, Czuba, Martina, Foldal, Cecilie, Malli, Armin, Klimkowicz-Pawlas, Agnieszka, Kukk, Liia, Lumini, Erica, Medina-Rolda\u0301n, Eduardo, Michel, Kerstin, Molina, Mari\u0301a Jose\u0301, O'Sullivan, Lilian, Pindral, Sylwia, Putku, Elsa, Kitzler, Barbara, Walter, Christian,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1016/j.scitotenv.2025.178646"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Science%20of%20The%20Total%20Environment", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.scitotenv.2025.178646", "name": "item", "description": "10.1016/j.scitotenv.2025.178646", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.scitotenv.2025.178646"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2025-02-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2008.05.007", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:17:15Z", "type": "Journal Article", "created": "2008-06-12", "title": "Long-Term Organic Farming Fosters Below And Aboveground Biota: Implications For Soil Quality, Biological Control And Productivity", "description": "Organic farming may contribute substantially to future agricultural production worldwide by improving soil quality and pest control, thereby reducing environmental impacts of conventional farming. We investigated in a comprehensive way soil chemical, as well as below and aboveground biological parameters of two organic and two conventional wheat farming systems that primarily differed in fertilization and weed management strategies. Contrast analyses identified management related differences between \u201cherbicide-free\u201d bioorganic (BIOORG) and biodynamic (BIODYN) systems and conventional systems with (CONFYM) or without manure (CONMIN) and herbicide application within a long-term agricultural experiment (DOK trial, Switzerland). Soil carbon content was significantly higher in systems receiving farmyard manure and concomitantly microbial biomass (fungi and bacteria) was increased. Microbial activity parameters, such as microbial basal respiration and nitrogen mineralization, showed an opposite pattern, suggesting that soil carbon in the conventional system (CONFYM) was more easily accessible to microorganisms than in organic systems. Bacterivorous nematodes and earthworms were most abundant in systems that received farmyard manure, which is in line with the responses of their potential food sources (microbes and organic matter). Mineral fertilizer application detrimentally affected enchytraeids and Diptera larvae, whereas aphids benefited. Spider abundance was favoured by organic management, most likely a response to increased prey availability from the belowground subsystem or increased weed coverage. In contrast to most soil-based, bottom-up controlled interactions, the twofold higher abundance of this generalist predator group in organic systems likely contributed to the significantly lower abundance of aboveground herbivore pests (aphids) in these systems. Long-term organic farming and the application of farmyard manure promoted soil quality, microbial biomass and fostered natural enemies and ecosystem engineers, suggesting enhanced nutrient cycling and pest control. Mineral fertilizers and herbicide application, in contrast, affected the potential for top-down control of aboveground pests negatively and reduced the organic carbon levels. Our study indicates that the use of synthetic fertilizers and herbicide application changes interactions within and between below and aboveground components, ultimately promoting negative environmental impacts of agriculture by reducing internal biological cycles and pest control. On the contrary, organic farming fosters microbial and faunal decomposers and this propagates into the aboveground system via generalist predators thereby increasing conservation biological control. However, grain and straw yields were 23% higher in systems receiving mineral fertilizers and herbicides reflecting the trade-off between productivity and environmental responsibility.", "keywords": ["[SDE] Environmental Sciences", "generalist predators", "respiration microbienne", "[SDV]Life Sciences [q-bio]", "faune du sol", "natural enemies", "alternative prey", "630", "nitrogen", "food-web", "Soil", "agriculture biologique", "cycle biologique", "herbicide", "min\u00e9ralisation de l'azote", "fertilisation organique", "fertilisation min\u00e9rale", "soil quality", "2. Zero hunger", "agriculture biodynamique", "agriculture conventionnelle", "nutrient cycling", "04 agricultural and veterinary sciences", "sustainability", "long terme", "6. Clean water", "[SDV] Life Sciences [q-bio]", "mycorrhizal fungi", "ennemi naturel", "microbial community structure", "ecosystem functioning", "[SDE]Environmental Sciences", "DOK trial;ecosystem functioning;farming system;fertilization;generalist predators;microbial community;nutrient cycling;natural enemies;soil fauna;soil quality;sustainability", "microbial community", "soil fauna", "agricultural systems", "management", "570", "agroecosystems", "Soil quality", "suisse", "productivit\u00e9", "Soil biology", "culture c\u00e9r\u00e9aliere", "triticum aestivum", "biomasse microbienne", "biomass", "DOK trial", "15. Life on land", "qualit\u00e9 biologique du sol", "fertilization", "13. Climate action", "Biodiversity and ecosystem services", "0401 agriculture", " forestry", " and fisheries", "farming system", "Cereals", " pulses and oilseeds"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2008.05.007"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2008.05.007", "name": "item", "description": "10.1016/j.soilbio.2008.05.007", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2008.05.007"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2008-09-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2009.12.015", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:17:17Z", "type": "Journal Article", "created": "2010-01-10", "title": "Interactions Between Residue Placement And Earthworm Ecological Strategy Affect Aggregate Turnover And N2o Dynamics In Agricultural Soil", "description": "Previous laboratory studies using epigeic and anecic earthworms have shown that earthworm activity can considerably increase nitrous oxide (N2O) emissions from crop residues in soils. However, the universality of this effect across earthworm functional groups and its underlying mechanisms remain unclear. The aims of this study were (i) to determine whether earthworms with an endogeic strategy also affect N2O emissions; (ii) to quantify possible interactions with epigeic earthworms; and (iii) to link these effects to earthworm-induced differences in selected soil properties. We initiated a 90-day 15N-tracer mesocosm study with the endogeic earthworm species Aporrectodea caliginosa (Savigny) and the epigeic species Lumbricus rubellus (Hoffmeister). 15N-labeled radish (Raphanus sativus cv. Adagio L.) residue was placed on top or incorporated into the loamy (Fluvaquent) soil. When residue was incorporated, only A. caliginosa significantly (p <0.01) increased cumulative N2O emissions from 1350 to 2223 \u00b5g N2O\u2013N kg-1 soil, with a corresponding increase in the turnover rate of macroaggregates. When residue was applied on top, L. rubellus significantly (p <0.001) increased emissions from 524 to 929 \u00b5g N2O\u2013N kg-1, and a significant (p <0.05) interaction between the two earthworm species increased emissions to 1397 \u00b5g N2O\u2013N kg-1. These effects coincided with an 84% increase in incorporation of residue 15N into the microaggregate fraction by A. caliginosa (p = 0.003) and an 85% increase in incorporation into the macroaggregate fraction by L. rubellus (p = 0.018). Cumulative CO2 fluxes were only significantly increased by earthworm activity (from 473.9 to 593.6 mg CO2\u2013C kg-1 soil; p = 0.037) in the presence of L. rubellus when residue was applied on top. We conclude that earthworm-induced N2O emissions reflect earthworm feeding strategies: epigeic earthworms can increase N2O emissions when residue is applied on top; endogeic earthworms when residue is incorporated into the soil by humans (tillage) or by other earthworm species. The effects of residue placement and earthworm addition are accompanied by changes in aggregate and SOM turnover, possibly controlling carbon, nitrogen and oxygen availability and therefore denitrification. Our results contribute to understanding the important but intricate relations between (functional) soil biodiversity and the soil greenhouse gas balance. Further research should focus on elucidating the links between the observed changes in soil aggregation and controls on denitrification, including the microbial community", "keywords": ["organic-matter dynamics", "2. Zero hunger", "crop residues", "denitrification", "ecosystem engineers", "casts", "no-tillage agroecosystems", "04 agricultural and veterinary sciences", "15. Life on land", "carbon-dioxide", "01 natural sciences", "630", "13. Climate action", "systems", "0401 agriculture", " forestry", " and fisheries", "nitrous-oxide fluxes", "management", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2009.12.015"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2009.12.015", "name": "item", "description": "10.1016/j.soilbio.2009.12.015", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2009.12.015"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-04-01T00:00:00Z"}}, {"id": "10.1016/j.still.2006.08.006", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:17:30Z", "type": "Journal Article", "created": "2006-09-27", "title": "Long-Term Impact Of Reduced Tillage And Residue Management On Soil Carbon Stabilization: Implications For Conservation Agriculture On Contrasting Soils", "description": "Residue retention and reduced tillage are both conservation agricultural management options that may enhance soil organic carbon (SOC) stabilization in tropical soils. Therefore, we evaluated the effects of long-term tillage and residue management on SOC dynamics in a Chromic Luvisol (red clay soil) and Areni-Gleyic Luvisol (sandy soil) in Zimbabwe. At the time of sampling the soils had been under conventional tillage (CT), mulch ripping (MR), clean ripping (CR) and tied ridging (TR) for 9 years. Soil was fully dispersed and separated into 212\u20132000 mm (coarse sand), 53\u2013212 mm (fine sand), 20\u201353 mm (coarse silt), 5\u201320 mm (fine silt) and 0\u20135 mm (clay) size fractions. The whole soil and size fractions were analyzed for C content. Conventional tillage treatments had the least amount of SOC, with 14.9 mg C g \ufffd 1 soil and 4.2 mg C g \ufffd 1 soil for the red clay and sandy soils, respectively. The highest SOC content was 6.8 mg C g \ufffd 1 soil in the sandy soil under MR, whereas for the red clay soil, TR had the highest SOC content of 20.4 mg C g \ufffd 1 soil. Organic C in the size fractions increased with decreasing size of the fractions. In both soils, the smallest response to management was observed in the clay size fractions, confirming that this size fraction is the most stable. The coarse sand-size fraction was most responsive to management in the sandy soil where MR had 42% more organic C than CR, suggesting that SOC contents of this fraction are predominantly controlled by amounts of C input. In contrast, the fine sand fraction was the most responsive fraction in the red clay soil with a 66% greater C content in the TR than CT. This result suggests that tillage disturbance is the dominant factor reducing C stabilization in a clayey soil, probably by reducing C stabilization within microaggregates. In conclusion, developing viable conservation agriculture practices to optimize SOC contents and long-term agroecosystem sustainability should prioritize the maintenance of C inputs (e.g. residue retention) to coarse textured soils, but should focus on the reduction of SOC decomposition (e.g. through reduced tillage) in fine textured soils. # 2006 Elsevier B.V. All rights reserved.", "keywords": ["organic-matter dynamics", "Soil management", "Conservation agriculture", "Residue management", "no-tillage", "continuous cultivation", "sudano-sahelian conditions", "loam soil", "Tropical agroecosystems", "Tillage", "Agricultural ecosystems", "conventional-tillage", "Field Scale", "Conservation tillage", "2. Zero hunger", "Tropical zones", "Soil organic matter", "microbial biomass", "Particulate organic matter (pom)", "Soil organic carbon", "04 agricultural and veterinary sciences", "15. Life on land", "6. Clean water", "crop residue", "fractions", "0401 agriculture", " forestry", " and fisheries", "manure application"]}, "links": [{"href": "https://doi.org/10.1016/j.still.2006.08.006"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20and%20Tillage%20Research", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.still.2006.08.006", "name": "item", "description": "10.1016/j.still.2006.08.006", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.still.2006.08.006"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2007-06-01T00:00:00Z"}}, {"id": "10.1016/j.still.2015.05.010", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:17:38Z", "type": "Journal Article", "created": "2015-06-03", "title": "Beneficial Effects Of Reduced Tillage And Green Manure On Soil Aggregation And Stabilization Of Organic Carbon In A Mediterranean Agroecosystem", "description": "Abstract   Semiarid Mediterranean agroecosystems need the implementation of sustainable land management (SLM) practices in order to maintain acceptable levels of soil organic matter (SOM). The application of SLM practices helps to maintain soil structure and physical-chemical protection of soil organic carbon (SOC), hence improving soil carbon sequestration and mitigating CO 2  emissions to the atmosphere. In an organic, rain-fed almond ( Prunus dulcis  Mill., var. Ferragnes) orchard under reduced tillage (RT), as the habitual management practice during the 14 years immediately preceding the experiment, we studied the effect of two agricultural management practices on soil aggregate distribution and SOC stabilization after four years of implementation. The implemented practices were (1) reduced tillage with a mix of  Vicia sativa  L. and  Avena sativa  L. as green manure (RTG) and (2) no-tillage (NT). Four aggregate size classes were differentiated by wet sieving (large and small macroaggregates, microaggregates, and the silt plus clay fraction), and the microaggregates occluded within small macroaggregates (SMm) were isolated. In addition, three organic C fractions were separated within the small macroaggregates and microaggregates, using a density fractionation method: free light fraction (free LF-C), intra-aggregate particulate OM (iPOM-C), and organic C associated with the mineral fraction (mineral-C). The results show that the combination of reduced tillage plus green manure (RTG) was the most-efficient SLM practice for SOC sequestration. The total SOC increased by about 14% in the surface layer (0\u20135\u00a0cm depth) when compared to RT. Furthermore, green manure counteracted the effect of tillage on soil aggregate rupture. The plant residue inputs from green manure and their incorporation into the soil by reduced tillage promoted the formation of new aggregates and activated the subsequent physical-chemical protection of OC. The latter mechanism occurred mainly in the fine iPOM-C occluded within microaggregates and mineral-C occluded within small macroaggregates fractions, which together contributed to an increase of up to 30% in the OC concentration in the bulk soil. No-tillage favored the OC accumulation in the mineral-C within the small macroaggregates and in the fine iPOM-C occluded within microaggregates in the surface layer, and in the mineral-C occluded within the small macroaggregates and microaggregates at 5\u201315\u00a0cm depth, but four years of cessation of tillage were not enough to significantly increase the total OC in the bulk soil.", "keywords": ["2. Zero hunger", "Carbon sequestration | Rain-fed almond orchard | Semiarid agroecosystems | Soil aggregation | Soil organic carbon fractionation | Sustainable land management", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "04 agricultural and veterinary sciences", "15. Life on land", "6. Clean water"]}, "links": [{"href": "https://doi.org/10.1016/j.still.2015.05.010"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20and%20Tillage%20Research", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.still.2015.05.010", "name": "item", "description": "10.1016/j.still.2015.05.010", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.still.2015.05.010"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2015-11-01T00:00:00Z"}}, {"id": "10.1038/srep06365", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:18:19Z", "type": "Journal Article", "created": "2014-09-15", "title": "Earthworms increase plant production: a meta-analysis", "description": "To meet the challenge of feeding a growing world population with minimal environmental impact, we need comprehensive and quantitative knowledge of ecological factors affecting crop production. Earthworms are among the most important soil dwelling invertebrates. Their activity affects both biotic and abiotic soil properties, in turn affecting plant growth. Yet, studies on the effect of earthworm presence on crop yields have not been quantitatively synthesized. Here we show, using meta-analysis, that on average earthworm presence in agroecosystems leads to a 25% increase in crop yield and a 23% increase in aboveground biomass. The magnitude of these effects depends on presence of crop residue, earthworm density and type and rate of fertilization. The positive effects of earthworms become larger when more residue is returned to the soil, but disappear when soil nitrogen availability is high. This suggests that earthworms stimulate plant growth predominantly through releasing nitrogen locked away in residue and soil organic matter. Our results therefore imply that earthworms are of crucial importance to decrease the yield gap of farmers who can't -or won't- use nitrogen fertilizer.", "keywords": ["Crops", " Agricultural", "agroecosystems", "Nitrogen", "growth", "n pools", "01 natural sciences", "nitrogen", "Article", "Animals", "Biomass", "soil carbon", "Oligochaeta", "Ecosystem", "agriculture", "0105 earth and related environmental sciences", "2. Zero hunger", "tolerance", "04 agricultural and veterinary sciences", "15. Life on land", "Carbon", "communities", "13. Climate action", "8. Economic growth", "0401 agriculture", " forestry", " and fisheries", "ecosystem services", "management"]}, "links": [{"href": "https://doi.org/10.1038/srep06365"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Scientific%20Reports", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1038/srep06365", "name": "item", "description": "10.1038/srep06365", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1038/srep06365"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2014-09-15T00:00:00Z"}}, {"id": "10.1111/1365-2664.13489", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:19:12Z", "type": "Journal Article", "created": "2019-08-19", "title": "Plant trait\u2010based approaches to improve nitrogen cycling in agroecosystems", "description": "Abstract<p>   <p>Intensive agriculture is dominated by monocultures of high\uffe2\uff80\uff90yielding plants that receive large applications of nitrogen (N) fertilizers to boost plant productivity. However, these systems have low N use efficiency (NUE) as fertilized plants generally take up less than half of the N applied. A large fraction of the remainder N is susceptible to be lost from the agroecosystem generating a cascade of environmental and socio\uffe2\uff80\uff90economic problems. Climate change and projected global increases in fertilizer use pose further risks to N losses and yield stability.</p>  <p>We review and translate concepts from ecology in natural systems to demonstrate that NUE in intensive agroecosystems can be strongly increased by fine\uffe2\uff80\uff90tuning the traits of the plant communities to the levels of N fertilization intensity.</p>  <p>We present key plant traits of importance for N\uffe2\uff80\uff90cycling (architectural, morphological and physiological traits, as well as symbiotic associations and exudation patterns); discuss ecological (with soil fauna and N\uffe2\uff80\uff90cycling microbial communities) and agronomic interactions of this approach; propose interdisciplinary methodologies for future research ranging from pot to global scales; and highlight possible solutions leading to an optimal balance between N fertilizer use and productivity.</p>  <p>Synthesis and applications. By showing the strong links between plant traits and nitrogen (N) cycling, our work opens possibilities to test ecologically informed hypotheses across gradients of soil fertility and N fertilizer management intensity, setting a research agenda for the coming years. Accordingly, the choice of plant species based on their functional traits will play a central role for the development of modern and productive agroecosystems that retain and use N more efficiently.</p>  </p", "keywords": ["580", "[SDE] Environmental Sciences", "2. Zero hunger", "570", "agroecosystems", "[SDV]Life Sciences [q-bio]", "nitrogen losses", "plant\u2013soil interactions", "04 agricultural and veterinary sciences", "15. Life on land", "fertilizer", "[SDV] Life Sciences [q-bio]", "nitrogen cycling", "plant traits", "13. Climate action", "[SDE]Environmental Sciences", "[SDV.BV]Life Sciences [q-bio]/Vegetal Biology", "0401 agriculture", " forestry", " and fisheries", "plant mixtures", "[SDV.BV] Life Sciences [q-bio]/Vegetal Biology", "functional traits", "plant-soil interactions"]}, "links": [{"href": "https://doi.org/10.1111/1365-2664.13489"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20of%20Applied%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/1365-2664.13489", "name": "item", "description": "10.1111/1365-2664.13489", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/1365-2664.13489"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-09-09T00:00:00Z"}}, {"id": "10.1111/ejss.13470", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:19:18Z", "type": "Journal Article", "created": "2024-03-14", "title": "Participatory soil citizen science: An unexploited resource for European soil research", "description": "Abstract<p>Soils are key components of our ecosystems and provide 95%\uffe2\uff80\uff9399% of our food. This importance is reflected by an increase in participatory citizen science projects on soils. Citizen science is a participatory research method that actively involves and engages the public in scientific enquiry to generate new knowledge or understanding. Here, we review past and current citizen science projects on agricultural soils across Europe. We conducted a web\uffe2\uff80\uff90based survey and described 24 reviewed European citizen science projects in the light of the 10 principles of citizen science and identified success factors for citizen science. Over 66% of the projects generated soil biodiversity data; 54% and 42% of the projects generated data on vegetation cover and soil organic carbon, respectively. Our findings show that soil citizen science projects aligned with the 10 principles of citizen science offer an unexploited resource for European soil health research. We conclude that promoting co\uffe2\uff80\uff90creation, fostering knowledge\uffe2\uff80\uff90sharing networks and enabling long\uffe2\uff80\uff90term communication and commitment with citizens are success factors for further development of citizen science on soils.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "570", "web-based survey", "soil health", "soil biodiversity", "[SDV.SA.SDS]Life Sciences [q-bio]/Agricultural sciences/Soil study", "15. Life on land", "01 natural sciences", "333", "12. Responsible consumption", "03 medical and health sciences", "13. Climate action", "EJPSOIL", "EJPSOIL", " European agroecosystems", " participatory research", " soil biodiversity", " soil health", " web-based survey", "11. Sustainability", "European agroecosystems", "participatory research", "[SDV.SA.SDS] Life Sciences [q-bio]/Agricultural sciences/Soil study", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://iris.cnr.it/bitstream/20.500.14243/469825/1/2024_European%20J%20Soil%20Scienc_Mason.pdf"}, {"href": "https://doi.org/10.1111/ejss.13470"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/ejss.13470", "name": "item", "description": "10.1111/ejss.13470", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/ejss.13470"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-03-01T00:00:00Z"}}, {"id": "10.1111/j.1365-2389.2005.00707.x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:19:28Z", "type": "Journal Article", "created": "2005-09-12", "title": "Long-Term Changes In Organic Matter Of Woodland Soils Cleared For Arable Cropping In Zimbabwe", "description": "Summary<p>Subsistence farmers in Africa depend largely on the soil organic matter to sustain crop productivity. Long\uffe2\uff80\uff90term changes in soil organic carbon and nitrogen were measured after woodland clearance for smallholder subsistence farming or for commercial farming. The contents of organic carbon and nitrogen in soil under reference woodlands were largest (53.3\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921, 4.88\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921) in a red clay soil (\uffe2\uff88\uffbc\uffe2\uff80\uff8350% clay + silt), followed by a granitic sand (\uffe2\uff88\uffbc\uffe2\uff80\uff8312% clay + silt; 22.8\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921, 1.47\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921) and least (19.5\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921, 0.88\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921) in a Kalahari sand (\uffe2\uff88\uffbc\uffe2\uff80\uff835% clay + silt). Organic carbon declined rapidly under cultivation to attain new equilibria within 10\uffe2\uff80\uff83years on all smallholdings. Greatest losses occurred in soils that initially contained most carbon and nitrogen in the order: red clay (22.4\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921 and 1.0\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921) &gt; granitic sand (13.2\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921 and 0.8\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921) &gt; Kalahari sand (10.6\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921 and 0.5\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921). On the clay soil, commercial farming with intensive use of mineral fertilizers and incorporation of maize stover led to more gradual decline: at equilibrium, contents of carbon and nitrogen were 15\uffe2\uff80\uff83t C ha\uffe2\uff88\uff921 and 1.7\uffe2\uff80\uff83t N ha\uffe2\uff88\uff921 greater than on smallholdings with similar soil and climate.</p><p>In the Kalahari sand the \uffce\uffb413C of organic C remained constant after woodland clearance, and maize contributed less than 10% of the total C even after 55\uffe2\uff80\uff83years. The \uffce\uffb413C signature increased slightly with increasing duration of cultivation by smallholders in the granitic sands and red clay soil where maize contributed 29% and 35% of the C at equilibrium. Under more productive commercial farming, the carbon derived from maize accounted for 50% of the total after 10\uffe2\uff80\uff83years of cultivation and 67% at equilibrium. The persistence of woodland carbon in the sandy soil is attributed to chemical stabilization resulting from large concentrations of lignin and polyphenols in the tree litter, or as charcoal.</p>", "keywords": ["2. Zero hunger", "agroecosystems", "c-13 natural-abundance", "carbon dynamics", "spodosols", "04 agricultural and veterinary sciences", "15. Life on land", "maize", "stabilization", "residues", "vegetation", "0401 agriculture", " forestry", " and fisheries", "sandy soils", "isotope"], "contacts": [{"organization": "Shamie Zingore, Ken E. Giller, Ken E. Giller, P. Nyamugafata, C. Manyame,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1111/j.1365-2389.2005.00707.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/j.1365-2389.2005.00707.x", "name": "item", "description": "10.1111/j.1365-2389.2005.00707.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/j.1365-2389.2005.00707.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2005-04-11T00:00:00Z"}}, {"id": "10.1111/j.1365-2389.2010.01313.x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:19:28Z", "type": "Journal Article", "created": "2010-11-16", "title": "Earthworm-Induced N Mineralization In Fertilized Grassland Increases Both N2o Emission And Crop-N Uptake", "description": "<p>Earthworms can increase plant nitrogen (N) availability by stimulating mineralization of organic matter. However, recent studies show that they can also cause elevated emission of the greenhouse gas nitrous oxide (N2O). It is unclear to what extent these two effects occur in fertilized grasslands, where earthworm densities are typically greatest. The aims of this study were therefore to (i) quantify the effects of earthworm activity on N uptake and N2O emissions in fertilized grasslands and (ii) link these effects to earthworm functional groups. In a 73\uffe2\uff80\uff90day factorial mesocosm experiment, combinations of Lumbricus rubellus (Lr, epigeic), Aporrectodea longa (Al, anecic) and Aporrectodea caliginosa (Ac, endogeic) individuals were introduced into columns with grass growing on a fertilized (250 kg N ha\uffe2\uff88\uff921) loamy soil. Introduction of Lr resulted in 50.8% (P &lt; 0.001) larger N2O emissions and 5.4% (P = 0.032) larger grass biomass. Grass\uffe2\uff80\uff90N uptake increased from 172 to 188 kg N ha\uffe2\uff88\uff921 in the presence of Lr (P &lt; 0.001), from 176 to 183 kg N ha\uffe2\uff88\uff921 in the presence of Ac (P = 0.001), and from 168 to 199 kg N ha\uffe2\uff88\uff921 when all three earthworm species were present (P = 0.006). Lr increased soil NH4+\uffe2\uff80\uff90N concentrations (P = 0.010), further indicating enhanced mineralization of N caused by earthworm activity. We conclude that the previously observed beneficial effect of earthworm presence on plant\uffe2\uff80\uff90N availability has a negative side\uffe2\uff80\uff90effect: increased emissions of the mineralized N as N2O.</p>", "keywords": ["forests", "2. Zero hunger", "agroecosystems", "habitat", "04 agricultural and veterinary sciences", "15. Life on land", "carbon-dioxide", "invasion", "populations", "fluxes", "soil-structure", "13. Climate action", "nitrous-oxide emission", "0401 agriculture", " forestry", " and fisheries", "organic-matter"]}, "links": [{"href": "https://doi.org/10.1111/j.1365-2389.2010.01313.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/j.1365-2389.2010.01313.x", "name": "item", "description": "10.1111/j.1365-2389.2010.01313.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/j.1365-2389.2010.01313.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-11-16T00:00:00Z"}}, {"id": "10.1111/j.1757-1707.2011.01130.x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:19:46Z", "type": "Journal Article", "created": "2011-11-02", "title": "Modeling Wildlife And Other Trade-Offs With Biofuel Crop Production", "description": "Abstract<p>Biofuels from agricultural sources are an important part ofCalifornia's strategy to reduce greenhouse gas emissions and dependence on foreign oil. Land conversion for agricultural and urban uses has already imperiled many animal species in the state. This study investigated the potential impacts on wildlife of shifts in agricultural activity to increase biomass production for transportation fuels. We applied knowledge of the suitability ofCalifornia's agricultural landscapes for wildlife species to evaluate wildlife effects associated with plausible scenarios of expanded production of three potential biofuel crops (sugar beets, bermudagrass, and canola). We also generated alternative, spatially explicit scenarios that minimized loss of habitat for the same level of biofuel production. We explored trade\uffe2\uff80\uff90offs to compare the marginal changes per unit of energy for transportation costs, wildlife, land and water\uffe2\uff80\uff90use, and total energy produced, and found that all five factors were influenced by crop choice. Sugar beet scenarios require the least land area: 3.5 times less land per liter of gasoline equivalent than bermudagrass and five times less than canola. Canola scenarios had the largest impacts on wildlife but the greatest reduction in water use. Bermudagrass scenarios resulted in a slight overall improvement for wildlife over the current situation. Relatively minor redistribution of lands converted to biofuel crops could produce the same energy yield with much less impact on wildlife and very small increases in transportation costs. This framework provides a means to systematically evaluate potential wildlife impacts of alternative production scenarios and could be a useful complement to other frameworks that assess impacts on ecosystem services and greenhouse gas emissions.</p>", "keywords": ["geographic information systems", "2. Zero hunger", "habitat suitability", "agroecosystems", "Life on Land", "California Wildlife Habitat Relationships system", "Agricultural Biotechnology", "0211 other engineering and technologies", "02 engineering and technology", "15. Life on land", "renewable energy", "7. Clean energy", "biofuels", "12. Responsible consumption", "Climate Action", "biomass feedstock", "trade-offs", "water demand", "13. Climate action", "11. Sustainability", "0202 electrical engineering", " electronic engineering", " information engineering", "Marxan"]}, "links": [{"href": "https://escholarship.org/content/qt40f8x430/qt40f8x430.pdf"}, {"href": "https://doi.org/10.1111/j.1757-1707.2011.01130.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/GCB%20Bioenergy", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/j.1757-1707.2011.01130.x", "name": "item", "description": "10.1111/j.1757-1707.2011.01130.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/j.1757-1707.2011.01130.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2011-11-02T00:00:00Z"}}, {"id": "10.1128/msystems.00344-21", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:19:55Z", "type": "Journal Article", "created": "2021-05-10", "title": "Network Properties of Local Fungal Communities Reveal the Anthropogenic Disturbance Consequences of Farming Practices in Vineyard Soils", "description": "<p>Soil fungal communities play a key role in agroecosystem sustainability. The complexity of fungal communities, at both taxonomic and functional levels, makes it difficult to find clear patterns connecting community composition with ecosystem function and to understand the impact of biotic (interspecies interactions) and abiotic (e.g., climate or anthropogenic disturbances) factors on it.</p>", "keywords": ["Ecolog\u00eda (Biolog\u00eda)", "0301 basic medicine", "2. Zero hunger", "0303 health sciences", "agroecosystems", "local networks", "Local networks", "Microbiolog\u00eda (Biolog\u00eda)", "579", "Ecolog\u00eda", "Emergent properties", "15. Life on land", "Microbiolog\u00eda", "fungal communities", "Microbiology", "574", "QR1-502", "Fungal communities", "03 medical and health sciences", "2401.06 Ecolog\u00eda animal", "emergent properties", "11. Sustainability", "2414 Microbiolog\u00eda", "Agroecosystems", "Research Article"]}, "links": [{"href": "https://journals.asm.org/doi/pdf/10.1128/mSystems.00344-21"}, {"href": "https://doi.org/10.1128/msystems.00344-21"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/mSystems", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1128/msystems.00344-21", "name": "item", "description": "10.1128/msystems.00344-21", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1128/msystems.00344-21"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-29T00:00:00Z"}}, {"id": "2969715914", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:27:24Z", "type": "Journal Article", "created": "2019-08-19", "title": "Plant trait\u2010based approaches to improve nitrogen cycling in agroecosystems", "description": "Abstract<p>   <p>Intensive agriculture is dominated by monocultures of high\uffe2\uff80\uff90yielding plants that receive large applications of nitrogen (N) fertilizers to boost plant productivity. However, these systems have low N use efficiency (NUE) as fertilized plants generally take up less than half of the N applied. A large fraction of the remainder N is susceptible to be lost from the agroecosystem generating a cascade of environmental and socio\uffe2\uff80\uff90economic problems. Climate change and projected global increases in fertilizer use pose further risks to N losses and yield stability.</p>  <p>We review and translate concepts from ecology in natural systems to demonstrate that NUE in intensive agroecosystems can be strongly increased by fine\uffe2\uff80\uff90tuning the traits of the plant communities to the levels of N fertilization intensity.</p>  <p>We present key plant traits of importance for N\uffe2\uff80\uff90cycling (architectural, morphological and physiological traits, as well as symbiotic associations and exudation patterns); discuss ecological (with soil fauna and N\uffe2\uff80\uff90cycling microbial communities) and agronomic interactions of this approach; propose interdisciplinary methodologies for future research ranging from pot to global scales; and highlight possible solutions leading to an optimal balance between N fertilizer use and productivity.</p>  <p>Synthesis and applications. By showing the strong links between plant traits and nitrogen (N) cycling, our work opens possibilities to test ecologically informed hypotheses across gradients of soil fertility and N fertilizer management intensity, setting a research agenda for the coming years. Accordingly, the choice of plant species based on their functional traits will play a central role for the development of modern and productive agroecosystems that retain and use N more efficiently.</p>  </p", "keywords": ["580", "[SDE] Environmental Sciences", "2. Zero hunger", "570", "agroecosystems", "[SDV]Life Sciences [q-bio]", "nitrogen losses", "plant\u2013soil interactions", "04 agricultural and veterinary sciences", "15. Life on land", "fertilizer", "[SDV] Life Sciences [q-bio]", "nitrogen cycling", "plant traits", "13. Climate action", "[SDE]Environmental Sciences", "[SDV.BV]Life Sciences [q-bio]/Vegetal Biology", "0401 agriculture", " forestry", " and fisheries", "plant mixtures", "[SDV.BV] Life Sciences [q-bio]/Vegetal Biology", "functional traits", "plant-soil interactions"]}, "links": [{"href": "https://doi.org/2969715914"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20of%20Applied%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "2969715914", "name": "item", "description": "2969715914", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/2969715914"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-09-09T00:00:00Z"}}, {"id": "10.17169/refubium-29038", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:20:38Z", "type": "Journal Article", "created": "2020-10-17", "title": "Protists and collembolans alter microbial community composition, C\u00a0dynamics and soil aggregation in simplified consumer\u2013prey systems", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Abstract. Microbes play an essential role in soil functioning including biogeochemical cycling and soil aggregate formation. Yet, a major challenge is to link microbes to higher trophic levels and assess consequences for soil functioning. Here, we aimed to assess how microbial consumers modify microbial community composition (PLFA markers), as well as C dynamics (microbial\u00a0C use, SOC concentration and CO2 emission) and soil aggregation. We rebuilt two simplified soil consumer\u2013prey systems: a bacterial-based system comprising amoebae (Acanthamoeba castellanii) feeding on a microbial community dominated by the free-living bacterium Pseudomonas fluorescens and a fungal-based system comprising collembolans (Heteromurus nitidus) grazing on a microbial community dominated by the saprotrophic fungus Chaetomium globosum. The amoeba A. castellanii did not affect microbial biomass and composition, but it enhanced the formation of soil aggregates and tended to reduce their stability. Presumably, the dominance of P. fluorescens, able to produce antibiotic toxins in response to the attack by A. castellanii, was the main cause of the unchanged microbial community composition, and the release of bacterial extracellular compounds, such as long-chained polymeric substances or proteases, in reaction to predation was responsible for the changes in soil aggregation as a side effect. In the fungal system, collembolans significantly modified microbial community composition via consumptive and non-consumptive effects including the transport of microbes on the body surface. As expected, fungal biomass promoted soil aggregation and was reduced in the presence of H. nitidus. Remarkably, we also found an unexpected contribution of changes in bacterial community composition to soil aggregation. In both the bacterial and fungal systems, bacterial and fungal communities mainly consumed C from soil organic matter (rather than the litter added). Increased fungal biomass was associated with an increased capture of C from added litter, and the presence of collembolans levelled off this effect. Neither amoebae nor collembolans altered SOC concentrations and CO2 production. Overall, the results demonstrated that trophic interactions are important for achieving a mechanistic understanding of biological contributions to soil aggregation and may occur without major changes in C dynamics and with or without changes in the composition of the microbial community.</p></article>", "keywords": ["2. Zero hunger", "570", "QE1-996.5", "Acanthamoeba castellanii", "life", "agroecosystems", "Ecology", "fatty-acid analysis", "Geology", "500 Naturwissenschaften und Mathematik::570 Biowissenschaften; Biologie::570 Biowissenschaften; Biologie", "04 agricultural and veterinary sciences", "stability", "15. Life on land", "01 natural sciences", "bacterial community", "diversity", "stabilization", "Life", "13. Climate action", "QH501-531", "0401 agriculture", " forestry", " and fisheries", "QH540-549.5", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.17169/refubium-29038"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biogeosciences", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.17169/refubium-29038", "name": "item", "description": "10.17169/refubium-29038", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.17169/refubium-29038"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-17T00:00:00Z"}}, {"id": "10.1890/13-0616.1", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:20:47Z", "type": "Journal Article", "created": "2013-09-11", "title": "Does agricultural crop diversity enhance soil microbial biomass and organic matter dynamics? A meta-analysis", "description": "<p>Our increasing dependence on a small number of agricultural crops, such as corn, is leading to reductions in agricultural biodiversity. Reductions in the number of crops in rotation or the replacement of rotations by monocultures are responsible for this loss of biodiversity. The belowground implications of simplifying agricultural plant communities remain unresolved; however, agroecosystem sustainability will be severely compromised if reductions in biodiversity reduce soil C and N concentrations, alter microbial communities, and degrade soil ecosystem functions as reported in natural communities. We conducted a meta\uffe2\uff80\uff90analysis of 122 studies to examine crop rotation effects on total soil C and N concentrations, and the faster cycling microbial biomass C and N pools that play key roles in soil nutrient cycling and physical processes such as aggregate formation. We specifically examined how rotation crop type and management practices influence C and N dynamics in different climates and soil types. We found that adding one or more crops in rotation to a monoculture increased total soil C by 3.6% and total N by 5.3%, but when rotations included a cover crop (i.e., crops that are not harvested but produced to enrich the soil and capture inorganic N), total C increased by 8.5% and total N 12.8%. Rotations substantially increased the soil microbial biomass C (20.7%) and N (26.1%) pools, and these overwhelming effects on microbial biomass were not moderated by crop type or management practices. Crop rotations, especially those that include cover crops, sustain soil quality and productivity by enhancing soil C, N, and microbial biomass, making them a cornerstone for sustainable agroecosystems.</p>", "keywords": ["Crops", " Agricultural", "2. Zero hunger", "microbial biomass", "soil nitrogen", "sustainable agroecosystems", "Agriculture", "04 agricultural and veterinary sciences", "Biogeochemistry", "15. Life on land", "12. Responsible consumption", "meta-analysis", "Soil", "crop rotation", "monoculture", "13. Climate action", "gricultural biodiversity", "0401 agriculture", " forestry", " and fisheries", "Biomass", "soil carbon", "Soil Microbiology"], "contacts": [{"organization": "McDaniel, Marshall D., Tiemann, Lisa K., Grandy, A. Stuart,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1890/13-0616.1"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecological%20Applications", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1890/13-0616.1", "name": "item", "description": "10.1890/13-0616.1", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1890/13-0616.1"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2014-04-01T00:00:00Z"}}, {"id": "10.5194/bg-17-4961-2020", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:22:45Z", "type": "Journal Article", "created": "2020-10-17", "title": "Protists and collembolans alter microbial community composition, C\u00a0dynamics and soil aggregation in simplified consumer\u2013prey systems", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Abstract. Microbes play an essential role in soil functioning including biogeochemical cycling and soil aggregate formation. Yet, a major challenge is to link microbes to higher trophic levels and assess consequences for soil functioning. Here, we aimed to assess how microbial consumers modify microbial community composition (PLFA markers), as well as C dynamics (microbial\u00a0C use, SOC concentration and CO2 emission) and soil aggregation. We rebuilt two simplified soil consumer\u2013prey systems: a bacterial-based system comprising amoebae (Acanthamoeba castellanii) feeding on a microbial community dominated by the free-living bacterium Pseudomonas fluorescens and a fungal-based system comprising collembolans (Heteromurus nitidus) grazing on a microbial community dominated by the saprotrophic fungus Chaetomium globosum. The amoeba A. castellanii did not affect microbial biomass and composition, but it enhanced the formation of soil aggregates and tended to reduce their stability. Presumably, the dominance of P. fluorescens, able to produce antibiotic toxins in response to the attack by A. castellanii, was the main cause of the unchanged microbial community composition, and the release of bacterial extracellular compounds, such as long-chained polymeric substances or proteases, in reaction to predation was responsible for the changes in soil aggregation as a side effect. In the fungal system, collembolans significantly modified microbial community composition via consumptive and non-consumptive effects including the transport of microbes on the body surface. As expected, fungal biomass promoted soil aggregation and was reduced in the presence of H. nitidus. Remarkably, we also found an unexpected contribution of changes in bacterial community composition to soil aggregation. In both the bacterial and fungal systems, bacterial and fungal communities mainly consumed C from soil organic matter (rather than the litter added). Increased fungal biomass was associated with an increased capture of C from added litter, and the presence of collembolans levelled off this effect. Neither amoebae nor collembolans altered SOC concentrations and CO2 production. Overall, the results demonstrated that trophic interactions are important for achieving a mechanistic understanding of biological contributions to soil aggregation and may occur without major changes in C dynamics and with or without changes in the composition of the microbial community.                     </p></article>", "keywords": ["2. Zero hunger", "570", "QE1-996.5", "Acanthamoeba castellanii", "life", "agroecosystems", "Ecology", "fatty-acid analysis", "Geology", "500 Naturwissenschaften und Mathematik::570 Biowissenschaften; Biologie::570 Biowissenschaften; Biologie", "04 agricultural and veterinary sciences", "stability", "15. Life on land", "01 natural sciences", "bacterial community", "diversity", "stabilization", "Life", "13. Climate action", "QH501-531", "0401 agriculture", " forestry", " and fisheries", "QH540-549.5", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.5194/bg-17-4961-2020"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biogeosciences", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.5194/bg-17-4961-2020", "name": "item", "description": "10.5194/bg-17-4961-2020", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5194/bg-17-4961-2020"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-17T00:00:00Z"}}, {"id": "10.3389/fenvs.2019.00131", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:21:39Z", "type": "Journal Article", "created": "2019-09-11", "title": "Assessing the Climate Regulation Potential of Agricultural Soils Using a Decision Support Tool Adapted to Stakeholders' Needs and Possibilities", "description": "Open AccessSoils perform many functions that are vital to societies, among which their capability to regulate global climate has received much attention over the past decades. An assessment of the extent to which soils perform a specific function is not only important to appropriately value their current capacity, but also to make well-informed decisions about how and where to change soil management to align the delivered soil functions with societal demands. To obtain an overview of the capacity of soils to perform different functions, accurate and easy-to-use models are necessary. A problem with most currently-available models is that data requirements often exceed data availability, while generally a high level of expert knowledge is necessary to apply these models. Therefore, we developed a qualitative model to assess how agricultural soils function with respect to climate regulation. The model is driven by inputs about agricultural management practices, soil properties and environmental conditions. To reduce data requirements on stakeholders, the 17 input variables are classified into either (1) three classes: low, medium and high or (2) the presence or absence of a management practice. These inputs are combined using a decision tree with internal integration rules to obtain an estimate of the magnitude of N2O emissions and carbon sequestration. These two variables are subsequently combined into an estimate of the capacity of a soil to perform the climate regulation function. The model was tested using data from long-term field experiments across Europe. This showed that the model is generally able to adequately assess this soil function across a range of environments under different management practices. In a next step, this model will be combined with models to assess other soil functions (soil biodiversity, primary productivity, nutrient cycling and water regulation and purification). This will allow the assessment of trade-offs between these soil functions for agricultural land across Europe.", "keywords": ["2. Zero hunger", "N2O emissions", "agroecosystems", "qualitative decision modeling", "04 agricultural and veterinary sciences", "soil functions", "15. Life on land", "climate regulation", "carbon sequestration", "Environmental sciences", "NO emissions", "13. Climate action", "11. Sustainability", "0401 agriculture", " forestry", " and fisheries", "GE1-350", "soil functions; climate regulation; carbon sequestration; N2O emissions; agroecosystems; qualitative decision modeling"]}, "links": [{"href": "https://doi.org/10.3389/fenvs.2019.00131"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Environmental%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/fenvs.2019.00131", "name": "item", "description": "10.3389/fenvs.2019.00131", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/fenvs.2019.00131"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-09-11T00:00:00Z"}}, {"id": "10.3389/fevo.2021.619215", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:21:40Z", "type": "Journal Article", "created": "2021-03-16", "title": "Ant Communities Resist Even in Small and Isolated Gypsum Habitat Remnants in a Mediterranean Agroecosystem", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Natural and seminatural habitat remnants play a crucial ecological role in intensified agroecosystems. Assumptions on the conservation value of small and poorly connected fragments in a hostile matrix come from generalization obtained from a limited number of taxa, mostly plants, and vertebrates. To date, few studies have analyzed the effect of fragmentation on ant communities in Mediterranean agroecosystems, despite the importance of this group of animals on several key ecosystem functions and services. Here, we analyze the effects of fragment area and connectivity on ant communities in gypsum outcrops in a large cereal agroecosystem of Central Spain. Ant communities were described by their species composition, abundance (total number of occurrences), and number of species, standardized both by area (species density), and abundance (species richness). Observed number of species was relatively high in comparison with other studies in the Mediterranean, and we found no effects of fragment characteristics on species density, species richness and species composition, which implies that even small and isolated patches do have a value for ant conservation. Moreover, total number of occurrences were higher for smaller and more isolated fragments. This finding contrasts with the results reported for other taxa in similar gypsum habitats and suggests that certain ant traits and strategies make them particularly resistant to fragmentation and capable to take advantage of small habitat patches. Given the important ecological role played by ants, we recommend the preservation of these small habitat fragments in the management plans of agroecosystems in these drylands, especially in those cases in which intensification of agricultural practices greatly diminish natural habitat availability.</p></article>", "keywords": ["0106 biological sciences", "2. Zero hunger", "drylands", "agroecosystems", "gypsum habitats", "Ecology", "Evolution", "Ants", "ants", "Biodiversity", "15. Life on land", "Biolog\u00eda y Biomedicina / Biolog\u00eda", "01 natural sciences", "13. Climate action", "fragmentation", "QH359-425", "biodiversity conservation", "Crematogaster", "14. Life underwater", "QH540-549.5"]}, "links": [{"href": "https://doi.org/10.3389/fevo.2021.619215"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/fevo.2021.619215", "name": "item", "description": "10.3389/fevo.2021.619215", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/fevo.2021.619215"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-03-16T00:00:00Z"}}, {"id": "10.3390/agronomy10101535", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:21:47Z", "type": "Journal Article", "created": "2020-10-09", "title": "Temporal and Cultivar-Specific Effects on Potato Root and Soil Fungal Diversity", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>The soil fungal community plays an important role in determining plant growth and health. In this study, we investigated the fungal diversity and community composition in the roots and soil of 21 potato (Solanum tuberosum L.) cultivars using high-throughput sequencing at three different time points across the growing season. In soil and roots, the fungal richness and relative abundance of pathogens and saprotrophs were mainly affected by sampling time. While sampling time affected fungal composition in soil, root fungal communities were also significantly affected by cultivar. The cultivar had the strongest effect on diversity of pathogens and abundance of particular pathogen species. Our results demonstrate changes in soil and root fungal communities of potato over the growing season, as well as highlighting the importance of potato cultivar on root fungal communities and abundance of pathogens.</p></article>", "keywords": ["0301 basic medicine", "2. Zero hunger", "0303 health sciences", "agroecosystems", "S", "high-throughput sequencing", "fungal guild", "<i>Solanum tuberosum</i>", "Agriculture", "15. Life on land", "fungal diversity", "03 medical and health sciences", "potato cultivars", "host specificity", "Solanum tuberosum"]}, "links": [{"href": "http://www.mdpi.com/2073-4395/10/10/1535/pdf"}, {"href": "https://www.mdpi.com/2073-4395/10/10/1535/pdf"}, {"href": "https://doi.org/10.3390/agronomy10101535"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Agronomy", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3390/agronomy10101535", "name": "item", "description": "10.3390/agronomy10101535", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3390/agronomy10101535"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-09T00:00:00Z"}}, {"id": "10.3390/land10060605", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:21:56Z", "type": "Journal Article", "created": "2021-06-07", "title": "Cultivated Land Use Zoning Based on Soil Function Evaluation from the Perspective of Black Soil Protection", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Given that cultivated land serves as a strategic resource to ensure national food security, blind emphasis on improvement of food production capacity can lead to soil overutilization and impair other soil functions. Therefore, we took Heilongjiang province as an example to conduct a multi-functional evaluation of soil at the provincial scale. A combination of soil, climate, topography, land use, and remote sensing data were used to evaluate the functions of primary productivity, provision and cycling of nutrients, provision of functional and intrinsic biodiversity, water purification and regulation, and carbon sequestration and regulation of cultivated land in 2018. We designed a soil function discriminant matrix, constructed the supply-demand ratio, and evaluated the current status of supply and demand of soil functions. Soil functions demonstrated a distribution pattern of high grade in the northeast and low grade in the southwest, mostly in second-level areas. The actual supply of primary productivity functions in 71.32% of the region cannot meet the current needs of the population. The dominant function of soil in 34.89% of the area is water purification and regulation, and most of the cultivated land belongs to the functional balance region. The results presented herein provide a theoretical basis for optimization of land patterns and improvement of cultivated land use management on a large scale, and is of great significance to the sustainable use of black soil resources and improvement of comprehensive benefits.</p></article>", "keywords": ["Heilongjiang province", "2. Zero hunger", "agroecosystems", "S", "spatial scales", "Agriculture", "04 agricultural and veterinary sciences", "15. Life on land", "soil multifunctionality", "6. Clean water", "13. Climate action", "11. Sustainability", "0401 agriculture", " forestry", " and fisheries", "supply and demand"]}, "links": [{"href": "http://www.mdpi.com/2073-445X/10/6/605/pdf"}, {"href": "https://doi.org/10.3390/land10060605"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Land", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3390/land10060605", "name": "item", "description": "10.3390/land10060605", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3390/land10060605"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-07T00:00:00Z"}}, {"id": "10.5281/zenodo.4476976", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:24:35Z", "type": "Journal Article", "created": "2020-10-09", "title": "Temporal and Cultivar-Specific Effects on Potato Root and Soil Fungal Diversity", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>The soil fungal community plays an important role in determining plant growth and health. In this study, we investigated the fungal diversity and community composition in the roots and soil of 21 potato (Solanum tuberosum L.) cultivars using high-throughput sequencing at three different time points across the growing season. In soil and roots, the fungal richness and relative abundance of pathogens and saprotrophs were mainly affected by sampling time. While sampling time affected fungal composition in soil, root fungal communities were also significantly affected by cultivar. The cultivar had the strongest effect on diversity of pathogens and abundance of particular pathogen species. Our results demonstrate changes in soil and root fungal communities of potato over the growing season, as well as highlighting the importance of potato cultivar on root fungal communities and abundance of pathogens.</p></article>", "keywords": ["2. Zero hunger", "0301 basic medicine", "0303 health sciences", "agroecosystems", "S", "high-throughput sequencing", "fungal guild", "<i>Solanum tuberosum</i>", "Agriculture", "15. Life on land", "fungal diversity", "03 medical and health sciences", "potato cultivars", "host specificity", "Solanum tuberosum"]}, "links": [{"href": "http://www.mdpi.com/2073-4395/10/10/1535/pdf"}, {"href": "https://www.mdpi.com/2073-4395/10/10/1535/pdf"}, {"href": "https://doi.org/10.5281/zenodo.4476976"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Agronomy", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.4476976", "name": "item", "description": "10.5281/zenodo.4476976", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.4476976"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-09T00:00:00Z"}}, {"id": "10.5281/zenodo.8091176", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:24:57Z", "type": "Journal Article", "created": "2021-06-07", "title": "Cultivated Land Use Zoning Based on Soil Function Evaluation from the Perspective of Black Soil Protection", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Given that cultivated land serves as a strategic resource to ensure national food security, blind emphasis on improvement of food production capacity can lead to soil overutilization and impair other soil functions. Therefore, we took Heilongjiang province as an example to conduct a multi-functional evaluation of soil at the provincial scale. A combination of soil, climate, topography, land use, and remote sensing data were used to evaluate the functions of primary productivity, provision and cycling of nutrients, provision of functional and intrinsic biodiversity, water purification and regulation, and carbon sequestration and regulation of cultivated land in 2018. We designed a soil function discriminant matrix, constructed the supply-demand ratio, and evaluated the current status of supply and demand of soil functions. Soil functions demonstrated a distribution pattern of high grade in the northeast and low grade in the southwest, mostly in second-level areas. The actual supply of primary productivity functions in 71.32% of the region cannot meet the current needs of the population. The dominant function of soil in 34.89% of the area is water purification and regulation, and most of the cultivated land belongs to the functional balance region. The results presented herein provide a theoretical basis for optimization of land patterns and improvement of cultivated land use management on a large scale, and is of great significance to the sustainable use of black soil resources and improvement of comprehensive benefits.</p></article>", "keywords": ["Heilongjiang province", "2. Zero hunger", "agroecosystems", "S", "spatial scales", "Agriculture", "04 agricultural and veterinary sciences", "15. Life on land", "soil multifunctionality", "6. Clean water", "13. Climate action", "11. Sustainability", "0401 agriculture", " forestry", " and fisheries", "supply and demand"]}, "links": [{"href": "http://www.mdpi.com/2073-445X/10/6/605/pdf"}, {"href": "https://doi.org/10.5281/zenodo.8091176"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Land", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.8091176", "name": "item", "description": "10.5281/zenodo.8091176", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.8091176"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-07T00:00:00Z"}}, {"id": "20.500.11850/366480", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:26:46Z", "type": "Journal Article", "created": "2019-09-11", "title": "Assessing the Climate Regulation Potential of Agricultural Soils Using a Decision Support Tool Adapted to Stakeholders' Needs and Possibilities", "description": "Open AccessSoils perform many functions that are vital to societies, among which their capability to regulate global climate has received much attention over the past decades. An assessment of the extent to which soils perform a specific function is not only important to appropriately value their current capacity, but also to make well-informed decisions about how and where to change soil management to align the delivered soil functions with societal demands. To obtain an overview of the capacity of soils to perform different functions, accurate and easy-to-use models are necessary. A problem with most currently-available models is that data requirements often exceed data availability, while generally a high level of expert knowledge is necessary to apply these models. Therefore, we developed a qualitative model to assess how agricultural soils function with respect to climate regulation. The model is driven by inputs about agricultural management practices, soil properties and environmental conditions. To reduce data requirements on stakeholders, the 17 input variables are classified into either (1) three classes: low, medium and high or (2) the presence or absence of a management practice. These inputs are combined using a decision tree with internal integration rules to obtain an estimate of the magnitude of N2O emissions and carbon sequestration. These two variables are subsequently combined into an estimate of the capacity of a soil to perform the climate regulation function. The model was tested using data from long-term field experiments across Europe. This showed that the model is generally able to adequately assess this soil function across a range of environments under different management practices. In a next step, this model will be combined with models to assess other soil functions (soil biodiversity, primary productivity, nutrient cycling and water regulation and purification). This will allow the assessment of trade-offs between these soil functions for agricultural land across Europe.", "keywords": ["2. Zero hunger", "N2O emissions", "agroecosystems", "qualitative decision modeling", "04 agricultural and veterinary sciences", "soil functions", "15. Life on land", "climate regulation", "carbon sequestration", "Environmental sciences", "NO emissions", "13. Climate action", "11. Sustainability", "0401 agriculture", " forestry", " and fisheries", "GE1-350", "soil functions; climate regulation; carbon sequestration; N2O emissions; agroecosystems; qualitative decision modeling"]}, "links": [{"href": "https://doi.org/20.500.11850/366480"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Environmental%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "20.500.11850/366480", "name": "item", "description": "20.500.11850/366480", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/20.500.11850/366480"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-09-11T00:00:00Z"}}, {"id": "10.7910/DVN/86009C", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:45Z", "type": "Dataset", "created": "2019-07-31", "title": "CROSST - Version 1.0.1", "description": "Open AccessCROSST is an Excel-based tool that assesses both agro-environmental and socio-economic impacts of Green Manure Cover Crop (GMCC) technologies. The tool quantifies gross economic margin, productivity (yield), soil health (N and P balances, soil structure, and soil organic carbon), required labor hours, and the trade-offs between these indicators. The tool was pilot-tested in Benin and Kenya under the BMZ-GIZ program on \u2018Soil Protection and Rehabilitation for Food Security.\u2019", "keywords": ["Agricultural Sciences", "Agrobiodiversity - AGBIO", "Earth and Environmental Sciences", "Africa", "Ex-ante impact assessment", "Economic analysis", "Environmental modelling", "Agroecosystems and Sustainable Landscapes - ASL", "Agronomy", "Productivity"]}, "links": [{"href": "https://doi.org/10.7910/DVN/86009C"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/86009C", "name": "item", "description": "10.7910/DVN/86009C", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/86009C"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-01-01T00:00:00Z"}}, {"id": "10.7910/DVN/9BGO2X", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:45Z", "type": "Dataset", "created": "2016-01-01", "title": "Replication Data for: Reducing losses but failing to sequester carbon in soils \u2013 the case of Conservation Agriculture and Integrated Soil Fertility Management in the humid tropical agro-ecosystem of Western Kenya", "description": "Soil organic carbon content of topsoil (0-15 cm depths) of two agronomic long-term trial (CT1 and INM3), collected repeatedly throughout the years", "keywords": ["Agricultural Sciences", "Conservation agriculture", "Soil organic carbon", "soil fertility", "conservation", "Soil fertility", "climate change mitigation", "soil organic carbon", "4p1000", "Climate change mitigation", "climate change", "Earth and Environmental Sciences", "greenhouse gases", "Greenhouse gas emissions", "Africa", "Climate change", "Agroecosystems and Sustainable Landscapes - ASL", "C-sink"], "contacts": [{"organization": "Sommer, Rolf, Paul, Birthe, Kihara, Job, Mukalama, John,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.7910/DVN/9BGO2X"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/9BGO2X", "name": "item", "description": "10.7910/DVN/9BGO2X", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/9BGO2X"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-01-01T00:00:00Z"}}, {"id": "10.7910/DVN/ESK6BB", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:45Z", "type": "Dataset", "title": "Current and future forage suitability maps for Rwanda and Tanzania", "description": "This data was produced using Targeting Tools \u2013 a web-based GIS tool, which matches a suitability criteria that include climate and environmental requirements for each of the forage varieties with a spatial database that\u2019s comprises organic carbon, soil PH, annual precipitation, mean temperature, growing days and elevation data to characterize the suitability.", "keywords": ["rwanda", "kenya", "Forage", "Agricultural Sciences", "Forage suitability", "Agrobiodiversity - AGBIO", "Earth and Environmental Sciences", "Maps", "Africa", "Rwanda", "forage", "Agroecosystems and Sustainable Landscapes - ASL", "Kenya"], "contacts": [{"organization": "Mutua, John, Notenbaert, An,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.7910/DVN/ESK6BB"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/ESK6BB", "name": "item", "description": "10.7910/DVN/ESK6BB", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/ESK6BB"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-01-01T00:00:00Z"}}, {"id": "10.7910/DVN/FNEGDP", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:45Z", "type": "Dataset", "title": "Current and future forage suitability maps for Ethiopia and Kenya", "description": "This data was produced using Targeting Tools \u2013 a web-based GIS tool, which matches a suitability criteria that include climate and environmental requirements for each of the forage varieties with a spatial database that\u2019s comprises organic carbon, soil PH, annual precipitation, mean temperature, growing days and elevation data to characterize the suitability.", "keywords": ["Forage", "Agricultural Sciences", "Forage suitability", "Agrobiodiversity - AGBIO", "Earth and Environmental Sciences", "Maps", "Africa", "forage", "Ethiopia", "Agroecosystems and Sustainable Landscapes - ASL", "Kenya"], "contacts": [{"organization": "Mutua, John, Notenbaert, An,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.7910/DVN/FNEGDP"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/FNEGDP", "name": "item", "description": "10.7910/DVN/FNEGDP", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/FNEGDP"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-01-01T00:00:00Z"}}, {"id": "10.7910/DVN/XZIRK0", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:47Z", "type": "Dataset", "title": "Baselines for land degradation neutrality indicators in the Omusati region, Namibia", "description": "This data was collected to develop baselines for three Land Degradation Neutrality (LDN) indicators: land use and land cover change (LUC) for the period 2001-2017, soil organic carbon (SOC) stocks for 2017 and bush density for 2017 as a baseline for bush encroachment in Omusati region, Namibia.", "keywords": ["SDG 15.3", "Land cover", "sustainable development", "UNCCD", "Land degradation neutrality", "Agricultural Sciences", "land degradation", "carbon", "Namibia", "Soil carbon", "Carbon", "soil", "Soil", "land cover", "Omusati", "Earth and Environmental Sciences", "Sustainable development", "Africa", "Bush density", "Land degradation", "Agroecosystems and Sustainable Landscapes - ASL"], "contacts": [{"organization": "Hengari, Simeon, Angombe, Simon, Katjioungua, Georgina, Fabiano, Ezequiel, Zauisomue, Erlich, Nakashona, Natalia, Ipinge, Selma, Andreas, Amon, Muhoko, Edward, Emvula, Emerit, Mutua, John, Kempen, Bas, Nijbroek, Ravic,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.7910/DVN/XZIRK0"}, {"rel": "self", "type": "application/geo+json", "title": "10.7910/DVN/XZIRK0", "name": "item", "description": "10.7910/DVN/XZIRK0", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7910/DVN/XZIRK0"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-01-01T00:00:00Z"}}, {"id": "10261/244257", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:25:55Z", "type": "Dataset", "title": "SHui open data research platform", "description": "Open AccessFor each data-file, the author (institution) of the file is given as \u201coperator\u201d.-- At project end, June 30th, 2022.-- For each data-file, the author/data owner for citation is given as \u201coperator\u201d and \u201ccontact\u201d.-- Plot data as .csv; catchment data ad libitum.", "keywords": ["2. Zero hunger", "Ensure availability and sustainable management of water and sanitation for all", "Water efficiency", "Agroecosystem", "Long-term agricultural experiments", "http://metadata.un.org/sdg/6", "SHui", "15. Life on land", "Open-data platform", "Soil and water", "13. Climate action", "Erosion", "Agroecosystems", "EU-China"], "contacts": [{"organization": "SHui Consortium", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10261/244257"}, {"rel": "self", "type": "application/geo+json", "title": "10261/244257", "name": "item", "description": "10261/244257", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/244257"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-01-01T00:00:00Z"}}, {"id": "10486/705687", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-04-13T16:26:08Z", "type": "Journal Article", "created": "2021-03-16", "title": "Ant Communities Resist Even in Small and Isolated Gypsum Habitat Remnants in a Mediterranean Agroecosystem", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Natural and seminatural habitat remnants play a crucial ecological role in intensified agroecosystems. Assumptions on the conservation value of small and poorly connected fragments in a hostile matrix come from generalization obtained from a limited number of taxa, mostly plants, and vertebrates. To date, few studies have analyzed the effect of fragmentation on ant communities in Mediterranean agroecosystems, despite the importance of this group of animals on several key ecosystem functions and services. Here, we analyze the effects of fragment area and connectivity on ant communities in gypsum outcrops in a large cereal agroecosystem of Central Spain. Ant communities were described by their species composition, abundance (total number of occurrences), and number of species, standardized both by area (species density), and abundance (species richness). Observed number of species was relatively high in comparison with other studies in the Mediterranean, and we found no effects of fragment characteristics on species density, species richness and species composition, which implies that even small and isolated patches do have a value for ant conservation. Moreover, total number of occurrences were higher for smaller and more isolated fragments. This finding contrasts with the results reported for other taxa in similar gypsum habitats and suggests that certain ant traits and strategies make them particularly resistant to fragmentation and capable to take advantage of small habitat patches. Given the important ecological role played by ants, we recommend the preservation of these small habitat fragments in the management plans of agroecosystems in these drylands, especially in those cases in which intensification of agricultural practices greatly diminish natural habitat availability.</p></article>", "keywords": ["2. Zero hunger", "0106 biological sciences", "drylands", "agroecosystems", "gypsum habitats", "Ecology", "Evolution", "Ants", "ants", "Biodiversity", "15. Life on land", "Biolog\u00eda y Biomedicina / Biolog\u00eda", "01 natural sciences", "13. Climate action", "fragmentation", "QH359-425", "biodiversity conservation", "Crematogaster", "14. Life underwater", "QH540-549.5"]}, "links": [{"href": "https://doi.org/10486/705687"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10486/705687", "name": "item", "description": "10486/705687", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10486/705687"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-03-16T00:00:00Z"}}, {"id": "20.500.14243/469825", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:26:53Z", "type": "Journal Article", "created": "2024-03-14", "title": "Participatory soil citizen science: An unexploited resource for European soil research", "description": "Abstract                   <p>Soils are key components of our ecosystems and provide 95%\uffe2\uff80\uff9399% of our food. This importance is reflected by an increase in participatory citizen science projects on soils. Citizen science is a participatory research method that actively involves and engages the public in scientific enquiry to generate new knowledge or understanding. Here, we review past and current citizen science projects on agricultural soils across Europe. We conducted a web\uffe2\uff80\uff90based survey and described 24 reviewed European citizen science projects in the light of the 10 principles of citizen science and identified success factors for citizen science. Over 66% of the projects generated soil biodiversity data; 54% and 42% of the projects generated data on vegetation cover and soil organic carbon, respectively. Our findings show that soil citizen science projects aligned with the 10 principles of citizen science offer an unexploited resource for European soil health research. We conclude that promoting co\uffe2\uff80\uff90creation, fostering knowledge\uffe2\uff80\uff90sharing networks and enabling long\uffe2\uff80\uff90term communication and commitment with citizens are success factors for further development of citizen science on soils.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "570", "web-based survey", "soil health", "soil biodiversity", "[SDV.SA.SDS]Life Sciences [q-bio]/Agricultural sciences/Soil study", "15. Life on land", "01 natural sciences", "333", "12. Responsible consumption", "03 medical and health sciences", "13. Climate action", "EJPSOIL", "EJPSOIL", " European agroecosystems", " participatory research", " soil biodiversity", " soil health", " web-based survey", "11. Sustainability", "European agroecosystems", "participatory research", "[SDV.SA.SDS] Life Sciences [q-bio]/Agricultural sciences/Soil study", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://iris.cnr.it/bitstream/20.500.14243/469825/1/2024_European%20J%20Soil%20Scienc_Mason.pdf"}, {"href": "https://doi.org/20.500.14243/469825"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "20.500.14243/469825", "name": "item", "description": "20.500.14243/469825", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/20.500.14243/469825"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-03-01T00:00:00Z"}}, {"id": "3091904565", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:27:37Z", "type": "Journal Article", "created": "2020-10-09", "title": "Temporal and Cultivar-Specific Effects on Potato Root and Soil Fungal Diversity", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>The soil fungal community plays an important role in determining plant growth and health. In this study, we investigated the fungal diversity and community composition in the roots and soil of 21 potato (Solanum tuberosum L.) cultivars using high-throughput sequencing at three different time points across the growing season. In soil and roots, the fungal richness and relative abundance of pathogens and saprotrophs were mainly affected by sampling time. While sampling time affected fungal composition in soil, root fungal communities were also significantly affected by cultivar. The cultivar had the strongest effect on diversity of pathogens and abundance of particular pathogen species. Our results demonstrate changes in soil and root fungal communities of potato over the growing season, as well as highlighting the importance of potato cultivar on root fungal communities and abundance of pathogens.</p></article>", "keywords": ["2. Zero hunger", "0301 basic medicine", "0303 health sciences", "agroecosystems", "S", "high-throughput sequencing", "fungal guild", "<i>Solanum tuberosum</i>", "Agriculture", "15. Life on land", "fungal diversity", "03 medical and health sciences", "potato cultivars", "host specificity", "Solanum tuberosum"]}, "links": [{"href": "http://www.mdpi.com/2073-4395/10/10/1535/pdf"}, {"href": "https://www.mdpi.com/2073-4395/10/10/1535/pdf"}, {"href": "https://doi.org/3091904565"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Agronomy", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3091904565", "name": "item", "description": "3091904565", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3091904565"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-09T00:00:00Z"}}, {"id": "3092924845", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:27:37Z", "type": "Journal Article", "created": "2020-10-17", "title": "Protists and collembolans alter microbial community composition, C\u00a0dynamics and soil aggregation in simplified consumer\u2013prey systems", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Abstract. Microbes play an essential role in soil functioning including biogeochemical cycling and soil aggregate formation. Yet, a major challenge is to link microbes to higher trophic levels and assess consequences for soil functioning. Here, we aimed to assess how microbial consumers modify microbial community composition (PLFA markers), as well as C dynamics (microbial\u00a0C use, SOC concentration and CO2 emission) and soil aggregation. We rebuilt two simplified soil consumer\u2013prey systems: a bacterial-based system comprising amoebae (Acanthamoeba castellanii) feeding on a microbial community dominated by the free-living bacterium Pseudomonas fluorescens and a fungal-based system comprising collembolans (Heteromurus nitidus) grazing on a microbial community dominated by the saprotrophic fungus Chaetomium globosum. The amoeba A. castellanii did not affect microbial biomass and composition, but it enhanced the formation of soil aggregates and tended to reduce their stability. Presumably, the dominance of P. fluorescens, able to produce antibiotic toxins in response to the attack by A. castellanii, was the main cause of the unchanged microbial community composition, and the release of bacterial extracellular compounds, such as long-chained polymeric substances or proteases, in reaction to predation was responsible for the changes in soil aggregation as a side effect. In the fungal system, collembolans significantly modified microbial community composition via consumptive and non-consumptive effects including the transport of microbes on the body surface. As expected, fungal biomass promoted soil aggregation and was reduced in the presence of H. nitidus. Remarkably, we also found an unexpected contribution of changes in bacterial community composition to soil aggregation. In both the bacterial and fungal systems, bacterial and fungal communities mainly consumed C from soil organic matter (rather than the litter added). Increased fungal biomass was associated with an increased capture of C from added litter, and the presence of collembolans levelled off this effect. Neither amoebae nor collembolans altered SOC concentrations and CO2 production. Overall, the results demonstrated that trophic interactions are important for achieving a mechanistic understanding of biological contributions to soil aggregation and may occur without major changes in C dynamics and with or without changes in the composition of the microbial community.                     </p></article>", "keywords": ["2. Zero hunger", "570", "QE1-996.5", "Acanthamoeba castellanii", "life", "agroecosystems", "Ecology", "fatty-acid analysis", "Geology", "500 Naturwissenschaften und Mathematik::570 Biowissenschaften; Biologie::570 Biowissenschaften; Biologie", "04 agricultural and veterinary sciences", "stability", "15. Life on land", "01 natural sciences", "bacterial community", "diversity", "stabilization", "Life", "13. Climate action", "QH501-531", "0401 agriculture", " forestry", " and fisheries", "QH540-549.5", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/3092924845"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biogeosciences", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3092924845", "name": "item", "description": "3092924845", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3092924845"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-17T00:00:00Z"}}, {"id": "3138037657", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-04-13T16:27:42Z", "type": "Journal Article", "created": "2021-03-16", "title": "Ant Communities Resist Even in Small and Isolated Gypsum Habitat Remnants in a Mediterranean Agroecosystem", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Natural and seminatural habitat remnants play a crucial ecological role in intensified agroecosystems. Assumptions on the conservation value of small and poorly connected fragments in a hostile matrix come from generalization obtained from a limited number of taxa, mostly plants, and vertebrates. To date, few studies have analyzed the effect of fragmentation on ant communities in Mediterranean agroecosystems, despite the importance of this group of animals on several key ecosystem functions and services. Here, we analyze the effects of fragment area and connectivity on ant communities in gypsum outcrops in a large cereal agroecosystem of Central Spain. Ant communities were described by their species composition, abundance (total number of occurrences), and number of species, standardized both by area (species density), and abundance (species richness). Observed number of species was relatively high in comparison with other studies in the Mediterranean, and we found no effects of fragment characteristics on species density, species richness and species composition, which implies that even small and isolated patches do have a value for ant conservation. Moreover, total number of occurrences were higher for smaller and more isolated fragments. This finding contrasts with the results reported for other taxa in similar gypsum habitats and suggests that certain ant traits and strategies make them particularly resistant to fragmentation and capable to take advantage of small habitat patches. Given the important ecological role played by ants, we recommend the preservation of these small habitat fragments in the management plans of agroecosystems in these drylands, especially in those cases in which intensification of agricultural practices greatly diminish natural habitat availability.</p></article>", "keywords": ["2. Zero hunger", "0106 biological sciences", "drylands", "agroecosystems", "gypsum habitats", "Ecology", "Evolution", "Ants", "ants", "Biodiversity", "15. Life on land", "Biolog\u00eda y Biomedicina / Biolog\u00eda", "01 natural sciences", "13. Climate action", "fragmentation", "QH359-425", "biodiversity conservation", "Crematogaster", "14. Life underwater", "QH540-549.5"]}, "links": [{"href": "https://doi.org/3138037657"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3138037657", "name": "item", "description": "3138037657", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3138037657"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-03-16T00:00:00Z"}}, {"id": "3172553460", "type": "Feature", "geometry": null, "properties": {"updated": "2026-04-13T16:27:45Z", "type": "Journal Article", "created": "2021-06-07", "title": "Cultivated Land Use Zoning Based on Soil Function Evaluation from the Perspective of Black Soil Protection", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Given that cultivated land serves as a strategic resource to ensure national food security, blind emphasis on improvement of food production capacity can lead to soil overutilization and impair other soil functions. Therefore, we took Heilongjiang province as an example to conduct a multi-functional evaluation of soil at the provincial scale. A combination of soil, climate, topography, land use, and remote sensing data were used to evaluate the functions of primary productivity, provision and cycling of nutrients, provision of functional and intrinsic biodiversity, water purification and regulation, and carbon sequestration and regulation of cultivated land in 2018. We designed a soil function discriminant matrix, constructed the supply-demand ratio, and evaluated the current status of supply and demand of soil functions. Soil functions demonstrated a distribution pattern of high grade in the northeast and low grade in the southwest, mostly in second-level areas. The actual supply of primary productivity functions in 71.32% of the region cannot meet the current needs of the population. The dominant function of soil in 34.89% of the area is water purification and regulation, and most of the cultivated land belongs to the functional balance region. The results presented herein provide a theoretical basis for optimization of land patterns and improvement of cultivated land use management on a large scale, and is of great significance to the sustainable use of black soil resources and improvement of comprehensive benefits.</p></article>", "keywords": ["Heilongjiang province", "2. Zero hunger", "agroecosystems", "S", "spatial scales", "Agriculture", "04 agricultural and veterinary sciences", "15. Life on land", "soil multifunctionality", "6. Clean water", "13. Climate action", "11. Sustainability", "0401 agriculture", " forestry", " and fisheries", "supply and demand"]}, "links": [{"href": "http://www.mdpi.com/2073-445X/10/6/605/pdf"}, {"href": "https://doi.org/3172553460"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Land", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3172553460", "name": "item", "description": "3172553460", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3172553460"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-07T00:00:00Z"}}, {"id": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[6.16, 50.16], [6.16, 51.32], [7.61, 51.32], [7.61, 50.16], [6.16, 50.16]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "GEMET - Concepts, version 2.4"}], "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Inplamint's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Inplamint and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-04-15", "type": "Dataset", "created": "2023-01-24", "language": "eng", "title": "Soil fungal community across a 52-year chronosequence of soil recultivation after open-mining in Inden, Germany", "description": "The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6\u00b015\u20190\u2019 E to 6\u00b021\u20190\u2019 E and 50\u00b050\u20195\u2019 N to 50\u00b053\u20190\u2019 N) of an open-cast lignite mine at Inden, between Cologne, Aachen, M\u00f6nchengladbach, and D\u00fcsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years, at samling time of 2016. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha\u22121 a\u22121 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). They are a total of 115 samples (5 replicates per field x 2 seasons, each field corresponds to a year of recultivation). Four samples were removed due to failed PCR. The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5\u2032\u2010GTGARTCATCGAATCTTTG\u20103\u2032 / ITS4: 5\u2032\u2010TCCTCCGCTTATTGATATGC\u20103\u2032). Amplicon sequence variants (ASVs) were inferred using DADA2 in R. Taxonomic annotations were performed using the IDTaxa algorithm implemented in the DECIPHER R package, against UNITE (version of 10.05.2021). Raw sequencing reads are available at ENA under study project PRJEB51095. The DNA sequences of the fungal amplicon sequence variants are available at ENA under accession numbers OV986018-OV989728. The processed dataset including the ASV count table, ASV taxonomy, and sample metadata compiled as a phyloseq R object stored in a single .RDS R file, as well as ASV guild annotation using Funguild database, are available at figshare at (https://doi.org/10.6084/m9.figshare.20160578). To read the data in the software R, use readRDS() function). Here we upload at the BONARES data centre the relative abundance of each fungal guild (% of DNA sequences) per samples along with basic metadata for easy reuse. The guild name and metadata name is provided in the header of each column. The entire set of measured soil physico-chemical parameters has been deposited at BONARES under reference 72ca6e98-5aab-4884-bf1b-56931482eb94. The publication associated to the dataset can be found at https://doi.org/10.1007/s00248-022-02058-w. Roy J, Reichel R, Br\u00fcggemann N, Rillig MC. 2022. Functional, not Taxonomic, Composition of Soil Fungi Reestablishes to Pre   mining Initial State After 52 Years of Recultivation. Microbial Ecology. Other publications associated to the datasets are : (1) Reichel R., H\u00e4nsch M., Br\u00fcggemann N. (2017). Indication of rapid soil food web recovery by nematode-derived indices in restored agricultural soil after open-cast lignite mining. Soil Biology and Biochemistry, 115, 261-264. DOI: 10.1016/j.soilbio.2017.08.020; (2) Roy J., Reichel R., Br\u00fcggemann N., Hempel S., Rillig M. (2017). Succession of arbuscular mycorrhizal fungi along a 52-years agricultural recultivation chronosequence. FEMS Microbiology Ecology. DOI: 1093/femsec/fix102", "formats": [{"name": "CSV"}], "keywords": ["Soil", "agriculture", "microbiology", "opendata", "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic", "Boden", "agriculture", "microbiology"], "contacts": [{"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "BonaRes Data Center", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Matthias Rillig", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "rrillig@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3541-7853", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Freie Universit\u00e4t Berlin;Forschungszentrum J\u00fclich GmbH", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4cf3c473-96a6-4660-b973-30c0f03c7cd2", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure1.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure2.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure3.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "name": "item", "description": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4cf3c473-96a6-4660-b973-30c0f03c7cd2"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-04-15T00:00:00Z"}}], "links": [{"rel": "self", "type": "application/geo+json", "title": "This document as GeoJSON", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Agroecosystems&f=json", "hreflang": "en-US"}, {"rel": "alternate", "type": "text/html", "title": "This document as HTML", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Agroecosystems&f=html", "hreflang": "en-US"}, {"rel": "collection", "type": "application/json", "title": "Collection URL", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main", "hreflang": "en-US"}, {"type": "application/geo+json", "rel": "first", "title": "items (first)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Agroecosystems&", "hreflang": "en-US"}, {"rel": "last", "type": "application/geo+json", "title": "items (last)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Agroecosystems&offset=46", "hreflang": "en-US"}], "numberMatched": 46, "numberReturned": 46, "distributedFeatures": [], "timeStamp": "2026-04-14T23:17:24.610839Z"}