{"type": "FeatureCollection", "features": [{"id": "10.1016/j.scitotenv.2023.166925", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:18:18Z", "type": "Journal Article", "created": "2023-09-09", "title": "Micro- and nanoplastics in soil: Linking sources to damage on soil ecosystem services in life cycle assessment", "description": "Soil ecosystems are crucial for providing vital ecosystem services (ES), and are increasingly pressured by the intensification and expansion of human activities, leading to potentially harmful consequences for their related ES provision. Micro- and nanoplastics (MNPs), associated with releases from various human activities, have become prevalent in various soil ecosystems and pose a global threat. Life Cycle Assessment (LCA), a tool for evaluating environmental performance of product and technology life cycles, has yet to adequately include MNPs-related damage to soil ES, owing to factors like uncertainties in MNPs environmental fate and ecotoxicological effects, and characterizing related damage on soil species loss, functional diversity, and ES. This study aims to address this gap by providing as a first step an overview of the current understanding of MNPs in soil ecosystems and proposing a conceptual approach to link MNPs impacts to soil ES damage. We find that MNPs pervade soil ecosystems worldwide, introduced through various pathways, including wastewater discharge, urban runoff, atmospheric deposition, and degradation of larger plastic debris. MNPs can inflict a range of ecotoxicity effects on soil species, including physical harm, chemical toxicity, and pollutants bioaccumulation. Methods to translate these impacts into damage on ES are under development and typically focus on discrete, yet not fully integrated aspects along the impact-to-damage pathway. We propose a conceptual framework for linking different MNPs effects on soil organisms to damage on soil species loss, functional diversity loss and loss of ES, and elaborate on each link. Proposed underlying approaches include the Threshold Indicator Taxa Analysis (TITAN) for translating ecotoxicological effects associated with MNPs into quantitative measures of soil species diversity damage; trait-based approaches for linking soil species loss to functional diversity loss; and ecological networks and Bayesian Belief Networks for linking functional diversity loss to soil ES damage. With the proposed conceptual framework, our study constitutes a starting point for including the characterization of MNPs-related damage on soil ES in LCA.", "keywords": ["2. Zero hunger", "Damage modeling", "Life Cycle Stages", "Terrestrial ecology", "Soil organisms", "Pollution and contamination", "Microplastics", "Bayes Theorem", "15. Life on land", "/dk/atira/pure/sustainabledevelopmentgoals/responsible_consumption_and_production; name=SDG 12 - Responsible Consumption and Production", "6. Clean water", "Soil sciences", "Soil", "/dk/atira/pure/sustainabledevelopmentgoals/affordable_and_clean_energy; name=SDG 7 - Affordable and Clean Energy", "13. Climate action", "Soil health", "11. Sustainability", "Biodiversity loss", "Humans", "Animals", "Life cycle impact assessment", "Soil ecosystem", "Ecosystem"]}, "links": [{"href": "https://doi.org/10.1016/j.scitotenv.2023.166925"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Science%20of%20The%20Total%20Environment", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.scitotenv.2023.166925", "name": "item", "description": "10.1016/j.scitotenv.2023.166925", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.scitotenv.2023.166925"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-12-01T00:00:00Z"}}, {"id": "10.1038/s41396-021-00906-0", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:19:19Z", "type": "Journal Article", "created": "2021-02-09", "title": "Soil microbial diversity\u2013biomass relationships are driven by soil carbon content across global biomes", "description": "Abstract                <p>The relationship between biodiversity and biomass has been a long standing debate in ecology. Soil biodiversity and biomass are essential drivers of ecosystem functions. However, unlike plant communities, little is known about how the diversity and biomass of soil microbial communities are interlinked across globally distributed biomes, and how variations in this relationship influence ecosystem function. To fill this knowledge gap, we conducted a field survey across global biomes, with contrasting vegetation and climate types. We show that soil carbon (C) content is associated to the microbial diversity\uffe2\uff80\uff93biomass relationship and ratio in soils across global biomes. This ratio provides an integrative index to identify those locations on Earth wherein diversity is much higher compared with biomass and vice versa. The soil microbial diversity-to-biomass ratio peaks in arid environments with low C content, and is very low in C-rich cold environments. Our study further advances that the reductions in soil C content associated with land use intensification and climate change could cause dramatic shifts in the microbial diversity-biomass ratio, with potential consequences for broad soil processes.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "570", "0303 health sciences", "550", "Microbiota", "Science::Geology", "Soil Science", "Biodiversity", ":Geology [Science]", "15. Life on land", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "Article", "Carbon", "Microbial Ecology", "Microbial ecology", "Soil", "03 medical and health sciences", "13. Climate action", "XXXXXX - Unknown", "http://metadata.un.org/sdg/15", "Biomass", "Ecosystem", "Soil Microbiology"]}, "links": [{"href": "https://doi.org/10.1038/s41396-021-00906-0"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/The%20ISME%20Journal", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1038/s41396-021-00906-0", "name": "item", "description": "10.1038/s41396-021-00906-0", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1038/s41396-021-00906-0"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-02-09T00:00:00Z"}}, {"id": "10.1038/s41559-022-01756-5", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:19:24Z", "type": "Journal Article", "created": "2022-05-09", "title": "Phylotype diversity within soil fungal functional groups drives ecosystem stability", "description": "Soil fungi are fundamental to plant productivity, yet their influence on the temporal stability of global terrestrial ecosystems, and their capacity to buffer plant productivity against extreme drought events, remain uncertain. Here we combined three independent global field surveys of soil fungi with a satellite-derived temporal assessment of plant productivity, and report that phylotype richness within particular fungal functional groups drives the stability of terrestrial ecosystems. The richness of fungal decomposers was consistently and positively associated with ecosystem stability worldwide, while the opposite pattern was found for the richness of fungal plant pathogens, particularly in grasslands. We further demonstrated that the richness of soil decomposers was consistently positively linked with higher resistance of plant productivity in response to extreme drought events, while that of fungal plant pathogens showed a general negative relationship with plant productivity resilience/resistance patterns. Together, our work provides evidence supporting the critical role of soil fungal diversity to secure stable plant production over time in global ecosystems, and to buffer against extreme climate events.", "keywords": ["0301 basic medicine", "Evolution", "Resistance", "580 Plants (Botany)", "Soil", "03 medical and health sciences", "10126 Department of Plant and Microbial Biology", "Behavior and Systematics", "Soil fungal", "XXXXXX - Unknown", "10211 Zurich-Basel Plant Science Center", "Phylotype diversity", "Ecosystem", "Soil Microbiology", "Productivity", "2. Zero hunger", "0303 health sciences", "Ecology", "Biodiversity", "Ecolog\u00eda", "Plants", "15. Life on land", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "Droughts", "1105 Ecology", " Evolution", " Behavior and Systematics", "13. Climate action", "Ecosystem stability", "http://metadata.un.org/sdg/15", "2303 Ecology"]}, "links": [{"href": "https://www.nature.com/articles/s41559-022-01756-5.pdf"}, {"href": "https://doi.org/10.1038/s41559-022-01756-5"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Nature%20Ecology%20%26amp%3B%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1038/s41559-022-01756-5", "name": "item", "description": "10.1038/s41559-022-01756-5", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1038/s41559-022-01756-5"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-05-09T00:00:00Z"}}, {"id": "10.1080/15324982.2022.2119901", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:20:01Z", "type": "Journal Article", "created": "2022-09-21", "title": "Plant-soil interactions in response to grazing intensity in a semi-arid ecosystem from NE Spain", "description": "Livestock grazing is an important element in ecosystem regulation since it may affect essential ecosystem functions, such as nutrient acquisition, organic matter decomposition, or litter accumulation in the soil. Overgrazing can threaten the conservation of ecosystems through excessive defoliation of plants or trampling. On the contrary, moderate grazing can have benefits on ecosystem dynamics by favoring nutrient cycling or the soil microbial activity. The aim of this study was to analyze these effects in a semi-arid Mediterranean shrubland located in NE Spain. We established six study sites including three grazing intensities, where we sampled vegetation biomass and soil properties: nitrogen content, microbial biomass, water infiltration capacity, porosity, and gypsum content. These parameters were included in a plant-soil interaction model tested through Structural Equation Modeling. Grazing had a direct negative effect on plant biomass (<i>p</i> &lt; 0.01) and water infiltration capacity (<i>p</i> &lt; 0.05) affecting soil nitrogen content (<i>p</i> &lt; 0.001) and microbial biomass (<i>p</i> &lt; 0.5), respectively. Infiltration capacity and porosity were primary drivers of plant biomass (<i>p</i> &lt; 0.05, both cases), and plant biomass was the main contributor to the soil nitrogen pool. Microbial biomass was dependent on infiltration capacity (<i>p</i> &lt; 0.05), porosity (<i>p</i> &lt; 0.01), and nitrogen (<i>p</i> &lt; 0.01). Grazing directly or indirectly affected the functioning of the ecosystem through effects on plant and soil attributes, which may result in changes in plant growth, litter decomposition, or plant nutrient acquisition. This study revealed that moderate grazing can maintain optimal ecosystem features and prevent ecosystem degradation.", "keywords": ["plant-soil feedbacks", "2. Zero hunger", "Plant biomass", "porosity", "microbial biomass", "Plant-soil feedbacks", "soil fertility", "Microbial biomass", "Infiltration", "04 agricultural and veterinary sciences", "15. Life on land", "Soil fertility", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "rangelands", "13. Climate action", "Rangelands", "http://metadata.un.org/sdg/15", "0401 agriculture", " forestry", " and fisheries", "Porosity", "plant biomass"]}, "links": [{"href": "https://www.tandfonline.com/doi/pdf/10.1080/15324982.2022.2119901"}, {"href": "https://doi.org/10.1080/15324982.2022.2119901"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Arid%20Land%20Research%20and%20Management", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1080/15324982.2022.2119901", "name": "item", "description": "10.1080/15324982.2022.2119901", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1080/15324982.2022.2119901"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-09-21T00:00:00Z"}}, {"id": "10.1111/cla.12208", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:20:30Z", "type": "Journal Article", "created": "2017-06-14", "title": "Hidden biodiversity: total evidence phylogenetics and evolution of morphological traits in a highly diverse lineage of endogean ground beetles,TyphlocharisDieck, 1869 (Carabidae, Trechinae, Anillini)", "description": "Abstract<p>Typhlocharisis the most diverse eyeless endogean ground beetle genus known to date, with 62 species all endemic to the West Mediterranean region. The lineage is characterized by a conservative and singular body plan within Carabidae that contrasts with a high morphological diversity in many traits. We provide an exhaustive phylogeny of the lineage through the study of 92 morphological characters from all 62 described species and 45 potential new species from 70 additional populations, and the combination of morphological and available molecular data, in the first total evidence phylogenetic approach for a highly diverse endogean lineage. We tracked the evolution of morphological traits over the obtained phylogenies. Results suggest eight morphologically distinct clades, which do not correspond to the species groups proposed formerly. Ancestral state reconstructions and phylogenetic signal analyses of morphological traits revealed that some of the previously key characters to the classification ofTyphlocharis, such as the umbilicate series or the apical denticles of elytra, are highly homoplasic, whereas other characters show stronger phylogenetic signal, including structures in the antennae, gula, pronotum and last abdominal ventrite. This evidence supports the split ofTyphlocharisinto three genera:Lusotyphlusgen. nov.;TyphlocharisDieck, 1869 andMicrocharidiusCoiffait, 1969 (revalidated), forming the subtribe Typhlocharina Jeanne, 1973.</p", "keywords": ["0106 biological sciences", "Evolution", "http://metadata.un.org/sdg/15", "Biodiversity", "15. Life on land", "Morphological traits", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "01 natural sciences"]}, "links": [{"href": "https://doi.org/10.1111/cla.12208"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Cladistics", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/cla.12208", "name": "item", "description": "10.1111/cla.12208", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/cla.12208"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2017-06-14T00:00:00Z"}}, {"id": "10.1111/mec.16716", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:21:05Z", "type": "Journal Article", "created": "2022-10-05", "title": "Metabarcoding for biodiversity inventory blind spots: A test case using the beetle fauna of an insular cloud forest", "description": "Abstract<p>Soils harbour a rich arthropod fauna, but many species are still not formally described (Linnaean shortfall) and the distribution of those already described is poorly understood (Wallacean shortfall). Metabarcoding holds much promise to fill this gap, however, nuclear copies of mitochondrial genes, and other artefacts lead to taxonomic inflation, which compromise the reliability of biodiversity inventories. Here, we explore the potential of a bioinformatic approach to jointly \uffe2\uff80\uff9cdenoise\uffe2\uff80\uff9d and filter nonauthentic mitochondrial sequences from metabarcode reads to obtain reliable soil beetle inventories and address open questions in soil biodiversity research, such as the scale of dispersal constraints in different soil layers. We sampled cloud forest arthropod communities from 49 sites in the Anaga peninsula of Tenerife (Canary Islands). We performed whole organism community DNA (wocDNA) metabarcoding, and built a local reference database with COI barcode sequences of 310 species of Coleoptera for filtering reads and the identification of metabarcoded species. This resulted in reliable haplotype data after considerably reducing nuclear mitochondrial copies and other artefacts. Comparing our results with previous beetle inventories, we found: (i) new species records, potentially representing undescribed species; (ii) new distribution records, and (iii) validated phylogeographic structure when compared with traditional sequencing approaches. Analyses also revealed evidence for higher dispersal constraint within deeper soil beetle communities, compared to those closer to the surface. The combined power of barcoding and metabarcoding contribute to mitigate the important shortfalls associated with soil arthropod diversity data, and thus address unresolved questions for this vast biodiversity fraction.</p", "keywords": ["0301 basic medicine", "0303 health sciences", "Reproducibility of Results", "Biodiversity", "Forests", "15. Life on land", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "Coleoptera", "Soil", "03 medical and health sciences", "metabarcoding", "http://metadata.un.org/sdg/15", "Animals", "DNA Barcoding", " Taxonomic", "taxonomic inflation", "Arthropods", "Barcoding", "mesofauna"]}, "links": [{"href": "https://doi.org/10.1111/mec.16716"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Molecular%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/mec.16716", "name": "item", "description": "10.1111/mec.16716", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/mec.16716"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-10-24T00:00:00Z"}}, {"id": "10.1111/nph.17065", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:21:06Z", "type": "Journal Article", "created": "2020-11-05", "title": "Soil biodiversity enhances the persistence of legumes under climate change", "description": "Summary<p>   <p>Global environmental change poses threats to plant and soil biodiversity. Yet, whether soil biodiversity loss can further influence plant community\uffe2\uff80\uff99s response to global change is still poorly understood.</p>  <p>We created a gradient of soil biodiversity using the dilution\uffe2\uff80\uff90to\uffe2\uff80\uff90extinction approach, and investigated the effects of soil biodiversity loss on plant communities during and following manipulations simulating global change disturbances in experimental grassland microcosms.</p>  <p>Grass and herb biomass was decreased by drought and promoted by nitrogen deposition, and a fast recovery was observed following disturbances, independently of soil biodiversity loss. Warming promoted herb biomass during and following disturbance only when soil biodiversity was not reduced. However, legumes biomass was suppressed by these disturbances, and there were more detrimental effects with reduced soil biodiversity. Moreover, soil biodiversity loss suppressed the recovery of legumes following these disturbances. Similar patterns were found for the response of plant diversity. The changes in legumes might be partly attributed to the loss of mycorrhizal soil mutualists.</p>  <p>Our study shows that soil biodiversity is crucial for legume persistence and plant diversity maintenance when faced with environmental change, highlighting the importance of soil biodiversity as a potential buffering mechanism for plant diversity and community composition in grasslands.</p>  </p>", "keywords": ["2. Zero hunger", "0301 basic medicine", "570", "0303 health sciences", "warming", "Climate Change", "Fabaceae", "arbuscular mycorrhizal fungi", "Biodiversity", "drought", "plant\u2013soil interactions", "500 Naturwissenschaften und Mathematik::570 Biowissenschaften; Biologie::570 Biowissenschaften; Biologie", "15. Life on land", "Grassland", "nitrogen deposition", "Soil", "03 medical and health sciences", "biodiversity loss", "13. Climate action", "Biomass", "dilution-to-extinction approach", "Soil Microbiology"]}, "links": [{"href": "https://nph.onlinelibrary.wiley.com/doi/pdf/10.1111/nph.17065"}, {"href": "https://doi.org/10.1111/nph.17065"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/New%20Phytologist", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/nph.17065", "name": "item", "description": "10.1111/nph.17065", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/nph.17065"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-12-08T00:00:00Z"}}, {"id": "10.3390/f13091456", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:23:23Z", "type": "Journal Article", "created": "2022-09-13", "title": "Knowledge about Plant Coexistence during Vegetation Succession for Forest Management on the Loess Plateau, China", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Coexistence between species within plant communities is a key issue in the practice of revegetation, forest management, and biodiversity conservation. Vegetation restoration is critical to control soil erosion and improve the ecological environment on the Loess Plateau. Here, we investigate the interspecific relationships of dominant plants during natural vegetation succession on the Loess Plateau. The results suggest that, under the ecological process of environmental filtering, species within communities can reduce interspecific competition and promote species coexistence via spatial heterogeneity and temporal asynchronous differences. The ecological niche overlap index (Oik) significantly and positively correlated with the strength of interspecific associations. Most species pairs had weak competition and more stable interspecific relationships. The results of the \u03c72 test showed that 317 species pairs were positively associated and 118 were negatively associated. The community is in a positive succession process, and the interaction relationship between species tends to be neutral. We should enhance the protection of positively associated species and pay attention to negatively associated species during forest management. Results revealed that Carex lanceolata Boott and Lespedeza bicolor Turcz coexisted easily with other species for mutual benefit, which could help build artificial forestland of native species to improve the ecological function.</p></article>", "keywords": ["Overlap", "2. Zero hunger", "0106 biological sciences", "Plant communities", "ecological niche; overlap; plant communities; interspecific relationship; biodiversity conservation; spatial heterogeneity", "Ecological niche", "http://metadata.un.org/sdg/15", "Spatial heterogeneity", "Interspecific relationship", "15. Life on land", "Biodiversity conservation", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "01 natural sciences"]}, "links": [{"href": "http://www.mdpi.com/1999-4907/13/9/1456/pdf"}, {"href": "https://www.mdpi.com/1999-4907/13/9/1456/pdf"}, {"href": "https://doi.org/10.3390/f13091456"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Forests", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3390/f13091456", "name": "item", "description": "10.3390/f13091456", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3390/f13091456"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-09-10T00:00:00Z"}}, {"id": "10.3897/soils4europe.e118853", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:23:47Z", "type": "Journal Article", "created": "2024-05-30", "title": "Preliminary assessment of the knowledge gaps to improve nature conservation of soil biodiversity", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p/></article>", "keywords": ["0301 basic medicine", "0303 health sciences", "03 medical and health sciences", "15. Life on land", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss"]}, "links": [{"href": "https://doi.org/10.3897/soils4europe.e118853"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soils%20for%20Europe", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3897/soils4europe.e118853", "name": "item", "description": "10.3897/soils4europe.e118853", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3897/soils4europe.e118853"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-05-30T00:00:00Z"}}, {"id": "10.5061/dryad.mkkwh715b", "type": "Feature", "geometry": null, "properties": {"license": "unspecified", "updated": "2026-06-26T16:24:09Z", "type": "Dataset", "title": "Data from: Positive plant diversity effects on soil microbial drought resistance are linked to variation in labile carbon and microbial community structure", "description": "Biodiversity loss and drought are substantially altering both above-and  belowground terrestrial ecosystem functioning, but mechanistic  understanding of plant diversity effects on the drought resistance of soil  microbial biomass remains limited.\u00a0 We designed a mesocosm  experiment to examine drought resistance of soil microbial biomass along a  plant species richness gradient (five plant species richness levels based  on old-field communities). We calculated resistance of microbial biomass  to drought and recorded key belowground properties which may influence  microbial resistance to drought (i.e., microbial diversity, microbial  community structure, soil carbon stocks and root biomass).\u00a0 Plant  species richness had a positive effect on microbial resistance to drought.  Variation in microbial resistance to drought was linked to properties of  the fungal community in ambient soil (Shannon diversity, arbuscular  mycorrhizal fungal richness and abundance) but not soil bacterial  diversity. Moreover, microbial resistance to drought increased with  increasing root biomass and dissolved organic carbon recorded under  ambient conditions.\u00a0 These results highlight the importance of  plant diversity for microbial biomass stability in our old-field study  system with implications for biogeochemical cycling, and suggest that  indirect effects of plant species richness on labile soil carbon and soil  fungi may drive resistance of soil microbial biomass to drought.", "keywords": ["2. Zero hunger", "resistance", "biodiversity loss", "ecosystem stability", "Drought", "13. Climate action", "plant-soil Interactions", "FOS: Biological sciences", "14. Life underwater", "15. Life on land", "6. Clean water"], "contacts": [{"organization": "Xi, Nianxun, Chen, Dongxia, Liu, Wei, Bloor, Juliette,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.mkkwh715b"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.mkkwh715b", "name": "item", "description": "10.5061/dryad.mkkwh715b", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.mkkwh715b"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-06-18T00:00:00Z"}}, {"id": "10.7934/p3243", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:02Z", "type": "Journal Article", "created": "2017-06-14", "title": "Hidden biodiversity: total evidence phylogenetics and evolution of morphological traits in a highly diverse lineage of endogean ground beetles,TyphlocharisDieck, 1869 (Carabidae, Trechinae, Anillini)", "description": "Abstract<p>Typhlocharisis the most diverse eyeless endogean ground beetle genus known to date, with 62 species all endemic to the West Mediterranean region. The lineage is characterized by a conservative and singular body plan within Carabidae that contrasts with a high morphological diversity in many traits. We provide an exhaustive phylogeny of the lineage through the study of 92 morphological characters from all 62 described species and 45 potential new species from 70 additional populations, and the combination of morphological and available molecular data, in the first total evidence phylogenetic approach for a highly diverse endogean lineage. We tracked the evolution of morphological traits over the obtained phylogenies. Results suggest eight morphologically distinct clades, which do not correspond to the species groups proposed formerly. Ancestral state reconstructions and phylogenetic signal analyses of morphological traits revealed that some of the previously key characters to the classification ofTyphlocharis, such as the umbilicate series or the apical denticles of elytra, are highly homoplasic, whereas other characters show stronger phylogenetic signal, including structures in the antennae, gula, pronotum and last abdominal ventrite. This evidence supports the split ofTyphlocharisinto three genera:Lusotyphlusgen. nov.;TyphlocharisDieck, 1869 andMicrocharidiusCoiffait, 1969 (revalidated), forming the subtribe Typhlocharina Jeanne, 1973.</p", "keywords": ["0106 biological sciences", "Evolution", "http://metadata.un.org/sdg/15", "Biodiversity", "15. Life on land", "Morphological traits", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "01 natural sciences"]}, "links": [{"href": "https://doi.org/10.7934/p3243"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Cladistics", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.7934/p3243", "name": "item", "description": "10.7934/p3243", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.7934/p3243"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2017-06-14T00:00:00Z"}}, {"id": "10072/426049", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:05Z", "type": "Journal Article", "created": "2023-09-09", "title": "Micro- and nanoplastics in soil: Linking sources to damage on soil ecosystem services in life cycle assessment", "description": "Soil ecosystems are crucial for providing vital ecosystem services (ES), and are increasingly pressured by the intensification and expansion of human activities, leading to potentially harmful consequences for their related ES provision. Micro- and nanoplastics (MNPs), associated with releases from various human activities, have become prevalent in various soil ecosystems and pose a global threat. Life Cycle Assessment (LCA), a tool for evaluating environmental performance of product and technology life cycles, has yet to adequately include MNPs-related damage to soil ES, owing to factors like uncertainties in MNPs environmental fate and ecotoxicological effects, and characterizing related damage on soil species loss, functional diversity, and ES. This study aims to address this gap by providing as a first step an overview of the current understanding of MNPs in soil ecosystems and proposing a conceptual approach to link MNPs impacts to soil ES damage. We find that MNPs pervade soil ecosystems worldwide, introduced through various pathways, including wastewater discharge, urban runoff, atmospheric deposition, and degradation of larger plastic debris. MNPs can inflict a range of ecotoxicity effects on soil species, including physical harm, chemical toxicity, and pollutants bioaccumulation. Methods to translate these impacts into damage on ES are under development and typically focus on discrete, yet not fully integrated aspects along the impact-to-damage pathway. We propose a conceptual framework for linking different MNPs effects on soil organisms to damage on soil species loss, functional diversity loss and loss of ES, and elaborate on each link. Proposed underlying approaches include the Threshold Indicator Taxa Analysis (TITAN) for translating ecotoxicological effects associated with MNPs into quantitative measures of soil species diversity damage; trait-based approaches for linking soil species loss to functional diversity loss; and ecological networks and Bayesian Belief Networks for linking functional diversity loss to soil ES damage. With the proposed conceptual framework, our study constitutes a starting point for including the characterization of MNPs-related damage on soil ES in LCA.", "keywords": ["2. Zero hunger", "Damage modeling", "Life Cycle Stages", "Terrestrial ecology", "Soil organisms", "Pollution and contamination", "Microplastics", "Bayes Theorem", "15. Life on land", "/dk/atira/pure/sustainabledevelopmentgoals/responsible_consumption_and_production; name=SDG 12 - Responsible Consumption and Production", "6. Clean water", "Soil sciences", "Soil", "/dk/atira/pure/sustainabledevelopmentgoals/affordable_and_clean_energy; name=SDG 7 - Affordable and Clean Energy", "13. Climate action", "Soil health", "11. Sustainability", "Biodiversity loss", "Humans", "Animals", "Life cycle impact assessment", "Soil ecosystem", "Ecosystem"]}, "links": [{"href": "https://doi.org/10072/426049"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Science%20of%20The%20Total%20Environment", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10072/426049", "name": "item", "description": "10072/426049", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10072/426049"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-12-01T00:00:00Z"}}, {"id": "10261/179752", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:09Z", "type": "Journal Article", "created": "2017-06-14", "title": "Hidden biodiversity: total evidence phylogenetics and evolution of morphological traits in a highly diverse lineage of endogean ground beetles,TyphlocharisDieck, 1869 (Carabidae, Trechinae, Anillini)", "description": "Abstract<p>Typhlocharisis the most diverse eyeless endogean ground beetle genus known to date, with 62 species all endemic to the West Mediterranean region. The lineage is characterized by a conservative and singular body plan within Carabidae that contrasts with a high morphological diversity in many traits. We provide an exhaustive phylogeny of the lineage through the study of 92 morphological characters from all 62 described species and 45 potential new species from 70 additional populations, and the combination of morphological and available molecular data, in the first total evidence phylogenetic approach for a highly diverse endogean lineage. We tracked the evolution of morphological traits over the obtained phylogenies. Results suggest eight morphologically distinct clades, which do not correspond to the species groups proposed formerly. Ancestral state reconstructions and phylogenetic signal analyses of morphological traits revealed that some of the previously key characters to the classification ofTyphlocharis, such as the umbilicate series or the apical denticles of elytra, are highly homoplasic, whereas other characters show stronger phylogenetic signal, including structures in the antennae, gula, pronotum and last abdominal ventrite. This evidence supports the split ofTyphlocharisinto three genera:Lusotyphlusgen. nov.;TyphlocharisDieck, 1869 andMicrocharidiusCoiffait, 1969 (revalidated), forming the subtribe Typhlocharina Jeanne, 1973.</p", "keywords": ["0106 biological sciences", "Evolution", "http://metadata.un.org/sdg/15", "Biodiversity", "15. Life on land", "Morphological traits", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "01 natural sciences"]}, "links": [{"href": "https://doi.org/10261/179752"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Cladistics", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10261/179752", "name": "item", "description": "10261/179752", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/179752"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2017-06-14T00:00:00Z"}}, {"id": "10261/295679", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:14Z", "type": "Journal Article", "created": "2022-09-21", "title": "Plant-soil interactions in response to grazing intensity in a semi-arid ecosystem from NE Spain", "description": "Livestock grazing is an important element in ecosystem regulation since it may affect essential ecosystem functions, such as nutrient acquisition, organic matter decomposition, or litter accumulation in the soil. Overgrazing can threaten the conservation of ecosystems through excessive defoliation of plants or trampling. On the contrary, moderate grazing can have benefits on ecosystem dynamics by favoring nutrient cycling or the soil microbial activity. The aim of this study was to analyze these effects in a semi-arid Mediterranean shrubland located in NE Spain. We established six study sites including three grazing intensities, where we sampled vegetation biomass and soil properties: nitrogen content, microbial biomass, water infiltration capacity, porosity, and gypsum content. These parameters were included in a plant-soil interaction model tested through Structural Equation Modeling. Grazing had a direct negative effect on plant biomass (<i>p</i> &lt; 0.01) and water infiltration capacity (<i>p</i> &lt; 0.05) affecting soil nitrogen content (<i>p</i> &lt; 0.001) and microbial biomass (<i>p</i> &lt; 0.5), respectively. Infiltration capacity and porosity were primary drivers of plant biomass (<i>p</i> &lt; 0.05, both cases), and plant biomass was the main contributor to the soil nitrogen pool. Microbial biomass was dependent on infiltration capacity (<i>p</i> &lt; 0.05), porosity (<i>p</i> &lt; 0.01), and nitrogen (<i>p</i> &lt; 0.01). Grazing directly or indirectly affected the functioning of the ecosystem through effects on plant and soil attributes, which may result in changes in plant growth, litter decomposition, or plant nutrient acquisition. This study revealed that moderate grazing can maintain optimal ecosystem features and prevent ecosystem degradation.", "keywords": ["plant-soil feedbacks", "2. Zero hunger", "Plant biomass", "porosity", "microbial biomass", "Plant-soil feedbacks", "soil fertility", "Microbial biomass", "Infiltration", "04 agricultural and veterinary sciences", "15. Life on land", "Soil fertility", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "rangelands", "13. Climate action", "Rangelands", "http://metadata.un.org/sdg/15", "0401 agriculture", " forestry", " and fisheries", "Porosity", "plant biomass"]}, "links": [{"href": "https://www.tandfonline.com/doi/pdf/10.1080/15324982.2022.2119901"}, {"href": "https://doi.org/10261/295679"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Arid%20Land%20Research%20and%20Management", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10261/295679", "name": "item", "description": "10261/295679", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/295679"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-09-21T00:00:00Z"}}, {"id": "10261/295770", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:14Z", "type": "Journal Article", "created": "2022-10-05", "title": "Metabarcoding for biodiversity inventory blind spots: A test case using the beetle fauna of an insular cloud forest", "description": "Abstract<p>Soils harbour a rich arthropod fauna, but many species are still not formally described (Linnaean shortfall) and the distribution of those already described is poorly understood (Wallacean shortfall). Metabarcoding holds much promise to fill this gap, however, nuclear copies of mitochondrial genes, and other artefacts lead to taxonomic inflation, which compromise the reliability of biodiversity inventories. Here, we explore the potential of a bioinformatic approach to jointly \uffe2\uff80\uff9cdenoise\uffe2\uff80\uff9d and filter nonauthentic mitochondrial sequences from metabarcode reads to obtain reliable soil beetle inventories and address open questions in soil biodiversity research, such as the scale of dispersal constraints in different soil layers. We sampled cloud forest arthropod communities from 49 sites in the Anaga peninsula of Tenerife (Canary Islands). We performed whole organism community DNA (wocDNA) metabarcoding, and built a local reference database with COI barcode sequences of 310 species of Coleoptera for filtering reads and the identification of metabarcoded species. This resulted in reliable haplotype data after considerably reducing nuclear mitochondrial copies and other artefacts. Comparing our results with previous beetle inventories, we found: (i) new species records, potentially representing undescribed species; (ii) new distribution records, and (iii) validated phylogeographic structure when compared with traditional sequencing approaches. Analyses also revealed evidence for higher dispersal constraint within deeper soil beetle communities, compared to those closer to the surface. The combined power of barcoding and metabarcoding contribute to mitigate the important shortfalls associated with soil arthropod diversity data, and thus address unresolved questions for this vast biodiversity fraction.</p", "keywords": ["0301 basic medicine", "0303 health sciences", "Reproducibility of Results", "Biodiversity", "Forests", "15. Life on land", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "Coleoptera", "Soil", "03 medical and health sciences", "metabarcoding", "http://metadata.un.org/sdg/15", "Animals", "DNA Barcoding", " Taxonomic", "taxonomic inflation", "Arthropods", "Barcoding", "mesofauna"]}, "links": [{"href": "https://doi.org/10261/295770"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Molecular%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10261/295770", "name": "item", "description": "10261/295770", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/295770"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-10-24T00:00:00Z"}}, {"id": "10261/308712", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:14Z", "type": "Journal Article", "created": "2022-09-12", "title": "Knowledge about Plant Coexistence during Vegetation Succession for Forest Management on the Loess Plateau, China", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Coexistence between species within plant communities is a key issue in the practice of revegetation, forest management, and biodiversity conservation. Vegetation restoration is critical to control soil erosion and improve the ecological environment on the Loess Plateau. Here, we investigate the interspecific relationships of dominant plants during natural vegetation succession on the Loess Plateau. The results suggest that, under the ecological process of environmental filtering, species within communities can reduce interspecific competition and promote species coexistence via spatial heterogeneity and temporal asynchronous differences. The ecological niche overlap index (Oik) significantly and positively correlated with the strength of interspecific associations. Most species pairs had weak competition and more stable interspecific relationships. The results of the \u03c72 test showed that 317 species pairs were positively associated and 118 were negatively associated. The community is in a positive succession process, and the interaction relationship between species tends to be neutral. We should enhance the protection of positively associated species and pay attention to negatively associated species during forest management. Results revealed that Carex lanceolata Boott and Lespedeza bicolor Turcz coexisted easily with other species for mutual benefit, which could help build artificial forestland of native species to improve the ecological function.</p></article>", "keywords": ["Overlap", "2. Zero hunger", "0106 biological sciences", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat desertification", " and halt and reverse land degradation and halt biodiversity loss", "Plant communities", "Ecological niche", "ecological niche; overlap; plant communities; interspecific relationship; biodiversity conservation; spatial heterogeneity", "http://metadata.un.org/sdg/15", "Spatial heterogeneity", "Interspecific relationship", "15. Life on land", "Biodiversity conservation", "01 natural sciences"]}, "links": [{"href": "http://www.mdpi.com/1999-4907/13/9/1456/pdf"}, {"href": "https://www.mdpi.com/1999-4907/13/9/1456/pdf"}, {"href": "https://doi.org/10261/308712"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Forests", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10261/308712", "name": "item", "description": "10261/308712", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/308712"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-09-10T00:00:00Z"}}, {"id": "10261/339529", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:16Z", "type": "Report", "title": "Understanding the measurements and variability of aerosol optical properties in NE Spain", "description": "Open Access[spa] Los aerosoles atmosf\u00e9ricos resultan claves a la hora de regular el clima de la Tierra, con un efecto sobre el clima estimado de enfriamiento a nivel global, si bien con una alta incertidumbre en su valor exacto. Es por ello necesario reducir dichas incertidumbres, principalmente asociadas a la alta variabilidad y heterogeneidad de su distribuci\u00f3n espacial y temporal, las m\u00faltiples especies de aerosoles con diferentes propiedades f\u00edsico-qu\u00edmicas, y los errores de medida. Las especies de aerosoles m\u00e1s relevantes debido a su efecto en el calentamiento del clima son el carbono negro (BC), la fracci\u00f3n absorbente de los aerosoles org\u00e1nicos (OA), i.e. carbono marr\u00f3n (BrC), y, potencialmente, el polvo mineral. Para el estudio de las propiedades \u00f3pticas de los aerosoles, esta tesis se ha centrado en un \u00e1rea con una gran variabilidad de fuentes de emisi\u00f3n de aerosoles de origen natural (biog\u00e9nicos, incendios, polvo mineral, sal marina) y antropog\u00e9nico (tr\u00e1fico, industria, viviendas, portuario, etc.) en el Mediterr\u00e1neo, en el NE de Espa\u00f1a. Esta \u00e1rea presenta una orograf\u00eda compleja que en combinaci\u00f3n con patrones atmosf\u00e9ricos que promueven los sistemas de brisas favorece la recirculaci\u00f3n de los aerosoles, generando m\u00faltiples capas de aerosoles. Adem\u00e1s, dichos escenarios pueden verse tambi\u00e9n influidos por la presencia de advecci\u00f3n de polvo mineral desde el N de \u00c1frica, contribuyendo significativamente a la concentraci\u00f3n de material particulado y afectando las propiedades \u00f3pticas. Con el fin de mejorar la caracterizaci\u00f3n de las propiedades \u00f3pticas del BC, el BrC y el polvo mineral en el NE de Espa\u00f1a, esta tesis ha llevado a cabo una serie de estudios centrada en: i) la mejora de la medida de la absorci\u00f3n analizando a trav\u00e9s de un m\u00e9todo novedoso el comportamiento de un par\u00e1metro clave para su obtenci\u00f3n mediante el aethalometro AE33, ii) la descripci\u00f3n de la variaci\u00f3n vertical de las propiedades f\u00edsico- qu\u00edmicas de los aerosoles atmosf\u00e9ricos durante eventos de recirculaci\u00f3n e intrusiones de polvo mineral el verano de 2015 a trav\u00e9s de la combinaci\u00f3n de vuelos instrumentados y medidas en las estaciones de medida, iii) el efecto de la mezcla de OA y aerosoles inorg\u00e1nicos con part\u00edculas de BC en su absorci\u00f3n, y iv) las propiedades \u00f3pticas del polvo mineral en una fuente de emisi\u00f3n en el Sahara seg\u00fan la intensidad de emisi\u00f3n.", "keywords": ["Aerosols", "Dispersi\u00f3 de la llum", "CIENCIAS DE LA ATMOSFERA", "Climatolog\u00eda general", "Meteorolog\u00eda", "Atmospheric physics", "F\u00edsica atmosf\u00e9rica", "Light scattering", "Optics", "Dust", "535", "Absorci\u00f3 de la llum", "\u00d2ptica", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "Ci\u00e8ncies Experimentals i Matem\u00e0tiques", "Absorci\u00f3n de la luz", "Polvo", "\u00d3ptica atmosf\u00e9ric", "F\u00edsica atmosf\u00e8rica", "Aerosoles", "Pols", "http://metadata.un.org/sdg/15", "Dispersi\u00f3n de la luz", "Light absorption", "\u00d3ptica"], "contacts": [{"organization": "Yus D\u00edez, Jes\u00fas", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10261/339529"}, {"rel": "self", "type": "application/geo+json", "title": "10261/339529", "name": "item", "description": "10261/339529", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/339529"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-01-01T00:00:00Z"}}, {"id": "10261/360070", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:18Z", "type": "Journal Article", "created": "2024-05-30", "title": "Preliminary assessment of the knowledge gaps to improve nature conservation of soil biodiversity", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p/></article>", "keywords": ["0301 basic medicine", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat desertification", " and halt and reverse land degradation and halt biodiversity loss", "0303 health sciences", "03 medical and health sciences", "http://metadata.un.org/sdg/15", "15. Life on land"]}, "links": [{"href": "https://doi.org/10261/360070"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soils%20for%20Europe", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10261/360070", "name": "item", "description": "10261/360070", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/360070"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-05-30T00:00:00Z"}}, {"id": "10261/384984", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:28:20Z", "type": "Dataset", "title": "[Dataset] Impact of Dust Source Patchiness on the Existence of a Constant Dust Flux Layer During Aeolian Erosion Events", "description": "Open AccessDust emission fluxes during wind soil erosion are usually estimated using a dust concentration vertical gradient, by assuming a constant dust flux layer between the surface and the dust measurement levels. Here, we investigate the existence of this layer during erosion events recorded in Iceland and Jordan. Size-resolved dust fluxes were estimated at three levels between 2 and 4\u00a0m using the eddy-covariance method. Dust fluxes were found mainly constant only between the two upper levels in Iceland, the lower dust flux being often stronger and richer in coarse particles, while dust fluxes in Jordan were nearly constant across all levels. The wind dynamics could not explain the absence of a constant dust flux layer in Iceland. We show that the presence of stationary dust source patches in Iceland, related to surface humidity, created a non-uniform dust layer near the surface, named dust roughness sublayer (DRSL), where individual plumes behind each patch interact but do not fully mix. The lowest dust measurement level was probably located within this sublayer while the upper ones were located above, such that there the emitted dust became spatially well-mixed. This explains near the surface in Iceland, the more intermittent dust concentration, its low correlation with the dust concentrations above, and the richer dust flux in coarse particles due to their lower deposition contribution. Our findings highlight the importance of estimating dust fluxes above a dust blending height whose characteristics depend on the dust source patchiness caused by surface humidity or the presence of sparse non-erosive elements.", "keywords": ["Make cities and human settlements inclusive", " safe", " resilient and sustainable", "Dust flux", "Build resilient infrastructure", " promote inclusive and sustainable industrialization and foster innovation", "Soil wind erosion", "Size distribution", "Constant flux layer", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss"], "contacts": [{"organization": "Dupont, S., Klose, M., Irvine, M. R., Gonz\u00e1lez-Fl\u00f3rez, C., Alastuey, Andr\u00e9s, Bonnefond, J. M., Dagsson-Waldhauserova, P., Gonzalez-Romero, A., Hussein, T., Lamaud, E., Meyer, H., Panta, A., Querol, Xavier, Schepanski, K., Vergara Palacio, S., Wieser, A., Yus-D\u00edez, Jes\u00fas, Kandler, K., P\u00e9rez Garc\u00eda-Pando, C.,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10261/384984"}, {"rel": "self", "type": "application/geo+json", "title": "10261/384984", "name": "item", "description": "10261/384984", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/384984"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2025-01-01T00:00:00Z"}}, {"id": "1959.7/uws:68562", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-26T16:29:05Z", "type": "Journal Article", "created": "2022-05-09", "title": "Phylotype diversity within soil fungal functional groups drives ecosystem stability", "description": "Soil fungi are fundamental to plant productivity, yet their influence on the temporal stability of global terrestrial ecosystems, and their capacity to buffer plant productivity against extreme drought events, remain uncertain. Here we combined three independent global field surveys of soil fungi with a satellite-derived temporal assessment of plant productivity, and report that phylotype richness within particular fungal functional groups drives the stability of terrestrial ecosystems. The richness of fungal decomposers was consistently and positively associated with ecosystem stability worldwide, while the opposite pattern was found for the richness of fungal plant pathogens, particularly in grasslands. We further demonstrated that the richness of soil decomposers was consistently positively linked with higher resistance of plant productivity in response to extreme drought events, while that of fungal plant pathogens showed a general negative relationship with plant productivity resilience/resistance patterns. Together, our work provides evidence supporting the critical role of soil fungal diversity to secure stable plant production over time in global ecosystems, and to buffer against extreme climate events.", "keywords": ["0301 basic medicine", "Evolution", "Resistance", "580 Plants (Botany)", "Soil", "03 medical and health sciences", "10126 Department of Plant and Microbial Biology", "Behavior and Systematics", "Soil fungal", "XXXXXX - Unknown", "10211 Zurich-Basel Plant Science Center", "Phylotype diversity", "Ecosystem", "Soil Microbiology", "Productivity", "2. Zero hunger", "0303 health sciences", "Ecology", "Biodiversity", "Ecolog\u00eda", "Plants", "15. Life on land", "Droughts", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat desertification", " and halt and reverse land degradation and halt biodiversity loss", "1105 Ecology", " Evolution", " Behavior and Systematics", "13. Climate action", "Ecosystem stability", "http://metadata.un.org/sdg/15", "2303 Ecology"]}, "links": [{"href": "https://www.nature.com/articles/s41559-022-01756-5.pdf"}, {"href": "https://doi.org/1959.7/uws:68562"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Nature%20Ecology%20%26amp%3B%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "1959.7/uws:68562", "name": "item", "description": "1959.7/uws:68562", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/1959.7/uws:68562"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-05-09T00:00:00Z"}}, {"id": "2445/193136", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-26T16:29:39Z", "type": "Report", "title": "Understanding the measurements and variability of aerosol optical properties in NE Spain", "description": "Open Access[spa] Los aerosoles atmosf\u00e9ricos resultan claves a la hora de regular el clima de la Tierra, con un efecto sobre el clima estimado de enfriamiento a nivel global, si bien con una alta incertidumbre en su valor exacto. Es por ello necesario reducir dichas incertidumbres, principalmente asociadas a la alta variabilidad y heterogeneidad de su distribuci\u00f3n espacial y temporal, las m\u00faltiples especies de aerosoles con diferentes propiedades f\u00edsico-qu\u00edmicas, y los errores de medida. Las especies de aerosoles m\u00e1s relevantes debido a su efecto en el calentamiento del clima son el carbono negro (BC), la fracci\u00f3n absorbente de los aerosoles org\u00e1nicos (OA), i.e. carbono marr\u00f3n (BrC), y, potencialmente, el polvo mineral. Para el estudio de las propiedades \u00f3pticas de los aerosoles, esta tesis se ha centrado en un \u00e1rea con una gran variabilidad de fuentes de emisi\u00f3n de aerosoles de origen natural (biog\u00e9nicos, incendios, polvo mineral, sal marina) y antropog\u00e9nico (tr\u00e1fico, industria, viviendas, portuario, etc.) en el Mediterr\u00e1neo, en el NE de Espa\u00f1a. Esta \u00e1rea presenta una orograf\u00eda compleja que en combinaci\u00f3n con patrones atmosf\u00e9ricos que promueven los sistemas de brisas favorece la recirculaci\u00f3n de los aerosoles, generando m\u00faltiples capas de aerosoles. Adem\u00e1s, dichos escenarios pueden verse tambi\u00e9n influidos por la presencia de advecci\u00f3n de polvo mineral desde el N de \u00c1frica, contribuyendo significativamente a la concentraci\u00f3n de material particulado y afectando las propiedades \u00f3pticas. Con el fin de mejorar la caracterizaci\u00f3n de las propiedades \u00f3pticas del BC, el BrC y el polvo mineral en el NE de Espa\u00f1a, esta tesis ha llevado a cabo una serie de estudios centrada en: i) la mejora de la medida de la absorci\u00f3n analizando a trav\u00e9s de un m\u00e9todo novedoso el comportamiento de un par\u00e1metro clave para su obtenci\u00f3n mediante el aethalometro AE33, ii) la descripci\u00f3n de la variaci\u00f3n vertical de las propiedades f\u00edsico- qu\u00edmicas de los aerosoles atmosf\u00e9ricos durante eventos de recirculaci\u00f3n e intrusiones de polvo mineral el verano de 2015 a trav\u00e9s de la combinaci\u00f3n de vuelos instrumentados y medidas en las estaciones de medida, iii) el efecto de la mezcla de OA y aerosoles inorg\u00e1nicos con part\u00edculas de BC en su absorci\u00f3n, y iv) las propiedades \u00f3pticas del polvo mineral en una fuente de emisi\u00f3n en el Sahara seg\u00fan la intensidad de emisi\u00f3n.", "keywords": ["Aerosols", "Dispersi\u00f3 de la llum", "CIENCIAS DE LA ATMOSFERA", "Climatolog\u00eda general", "Meteorolog\u00eda", "Atmospheric physics", "F\u00edsica atmosf\u00e9rica", "Light scattering", "Optics", "Dust", "535", "Absorci\u00f3 de la llum", "\u00d2ptica", "Protect", " restore and promote sustainable use of terrestrial ecosystems", " sustainably manage forests", " combat\u00a0desertification", " and halt and reverse land degradation and halt biodiversity loss", "Ci\u00e8ncies Experimentals i Matem\u00e0tiques", "Absorci\u00f3n de la luz", "Polvo", "\u00d3ptica atmosf\u00e9ric", "F\u00edsica atmosf\u00e8rica", "Aerosoles", "Pols", "http://metadata.un.org/sdg/15", "Dispersi\u00f3n de la luz", "Light absorption", "\u00d3ptica"], "contacts": [{"organization": "Yus D\u00edez, Jes\u00fas", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/2445/193136"}, {"rel": "self", "type": "application/geo+json", "title": "2445/193136", "name": "item", "description": "2445/193136", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/2445/193136"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-01-01T00:00:00Z"}}, {"id": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[6.16, 50.16], [6.16, 51.32], [7.61, 51.32], [7.61, 50.16], [6.16, 50.16]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "GEMET - Concepts, version 2.4"}], "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Inplamint's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Inplamint and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-04-15", "type": "Dataset", "created": "2023-01-24", "language": "eng", "title": "Soil fungal community across a 52-year chronosequence of soil recultivation after open-mining in Inden, Germany", "description": "The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6\u00b015\u20190\u2019 E to 6\u00b021\u20190\u2019 E and 50\u00b050\u20195\u2019 N to 50\u00b053\u20190\u2019 N) of an open-cast lignite mine at Inden, between Cologne, Aachen, M\u00f6nchengladbach, and D\u00fcsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years, at samling time of 2016. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha\u22121 a\u22121 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). They are a total of 115 samples (5 replicates per field x 2 seasons, each field corresponds to a year of recultivation). Four samples were removed due to failed PCR. The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5\u2032\u2010GTGARTCATCGAATCTTTG\u20103\u2032 / ITS4: 5\u2032\u2010TCCTCCGCTTATTGATATGC\u20103\u2032). Amplicon sequence variants (ASVs) were inferred using DADA2 in R. Taxonomic annotations were performed using the IDTaxa algorithm implemented in the DECIPHER R package, against UNITE (version of 10.05.2021). Raw sequencing reads are available at ENA under study project PRJEB51095. The DNA sequences of the fungal amplicon sequence variants are available at ENA under accession numbers OV986018-OV989728. The processed dataset including the ASV count table, ASV taxonomy, and sample metadata compiled as a phyloseq R object stored in a single .RDS R file, as well as ASV guild annotation using Funguild database, are available at figshare at (https://doi.org/10.6084/m9.figshare.20160578). To read the data in the software R, use readRDS() function). Here we upload at the BONARES data centre the relative abundance of each fungal guild (% of DNA sequences) per samples along with basic metadata for easy reuse. The guild name and metadata name is provided in the header of each column. The entire set of measured soil physico-chemical parameters has been deposited at BONARES under reference 72ca6e98-5aab-4884-bf1b-56931482eb94. The publication associated to the dataset can be found at https://doi.org/10.1007/s00248-022-02058-w. Roy J, Reichel R, Br\u00fcggemann N, Rillig MC. 2022. Functional, not Taxonomic, Composition of Soil Fungi Reestablishes to Pre   mining Initial State After 52 Years of Recultivation. Microbial Ecology. Other publications associated to the datasets are : (1) Reichel R., H\u00e4nsch M., Br\u00fcggemann N. (2017). Indication of rapid soil food web recovery by nematode-derived indices in restored agricultural soil after open-cast lignite mining. Soil Biology and Biochemistry, 115, 261-264. DOI: 10.1016/j.soilbio.2017.08.020; (2) Roy J., Reichel R., Br\u00fcggemann N., Hempel S., Rillig M. (2017). Succession of arbuscular mycorrhizal fungi along a 52-years agricultural recultivation chronosequence. FEMS Microbiology Ecology. DOI: 1093/femsec/fix102", "formats": [{"name": "CSV"}], "keywords": ["Soil", "agriculture", "microbiology", "opendata", "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic", "Boden", "agriculture", "microbiology"], "contacts": [{"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "BonaRes Data Center", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Matthias Rillig", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "rrillig@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3541-7853", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Freie Universit\u00e4t Berlin;Forschungszentrum J\u00fclich GmbH", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4cf3c473-96a6-4660-b973-30c0f03c7cd2", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure1.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure2.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure3.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "name": "item", "description": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4cf3c473-96a6-4660-b973-30c0f03c7cd2"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-04-15T00:00:00Z"}}], "links": [{"rel": "self", "type": "application/geo+json", "title": "This document as GeoJSON", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Biodiversity+loss&f=json", "hreflang": "en-US"}, {"rel": "alternate", "type": "text/html", "title": "This document as HTML", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Biodiversity+loss&f=html", "hreflang": "en-US"}, {"rel": "collection", "type": "application/json", "title": "Collection URL", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main", "hreflang": "en-US"}, {"type": "application/geo+json", "rel": "first", "title": "items (first)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Biodiversity+loss&", "hreflang": "en-US"}, {"rel": "last", "type": "application/geo+json", "title": "items (last)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Biodiversity+loss&offset=22", "hreflang": "en-US"}], "numberMatched": 22, "numberReturned": 22, "distributedFeatures": [], "timeStamp": "2026-06-27T00:33:00.382476Z"}