{"type": "FeatureCollection", "features": [{"id": "10.5281/zenodo.7656722", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:24:37Z", "type": "Dataset", "title": "Data for: The effect of land-use change on soil C, N, P, and their stoichiometries: A global synthesis", "description": "Open Access<strong><em>Data description</em></strong> This dataset includes detailed information about five different types of land use change reported in \u201cThe effect of land-use change on soil C, N, P, and their stoichiometries: A global synthesis (Agriculture, Ecosystems and Environment; https://doi.org/10.1016/j.agee.2023.108402)\u201d. Lists of five different types of land use change 1) conversion of primary forest to cropland 2) conversion of primary forest to grassland 3) conversion of cropland to forest 4) conversion of grassland to forest 5) conversion of grassland to cropland Lists of detailed information Land use change (pre-LUC, post-LUC) Country, Location, Geographic position (Longitude, Latitude) Altitude (m) Climate zone Weather [rainfall (mm yr<sup>-1</sup>) and temperature (\u00b0C)] Reported time of change (years) Vegetation type (pre-LUC, post-LUC) Fertilizer (pre-LUC, post-LUC: type, application; change) Soil sampling depth (cm) Soil type [units, pre-LUC, post-LUC, change rate (%)] Soil pH, bulk density, CEC [units, pre-LUC, post-LUC, change rate (%)] Soil organic carbon [units, pre-LUC, post-LUC, change rate (%)] Soil total nitrogen [units, pre-LUC, post-LUC, change rate (%)] Soil total phosphorus [units, pre-LUC, post-LUC, change rate (%)] Soil C:N [units, pre-LUC, post-LUC, change rate (%)] Soil C:P [units, pre-LUC, post-LUC, change rate (%)] Soil N:P [units, pre-LUC, post-LUC, change rate (%)] Reference <em><strong>Data collection method</strong></em> We analyzed five different types of LUC: 1) conversion of primary forest to cropland, 2) conversion of primary forest to grassland, 3) conversion of cropland to forest, 4) conversion of grassland to forest, and 5) conversion of grassland to cropland. We classified primary forest as forest that had not previously been cleared and used for other land uses. The conversion of cropland or grassland to forest includes naturally generated and intentionally planted forest. Cropland is land used for growing agricultural crops and may include short pasture phases, and grassland is land used continuously for grazing purposes, but may include occasional and repeated pasture-renewal phases. While we tried to make categorical distinctions between these land-use types, land uses are often more fluid in practice, which may not always have been stated in the publications underlying our data compilation. When a paper reported both contents and stocks, we used the stock-based measure. We used reported stocks if the original work had already been corrected to equivalent soil mass (Ellert and Bettany, 1995) or if corrected stocks had been reported in previous reviews or meta-analyses (Don et al., 2011; Poeplau et al., 2011; Guo and Gifford, 2002). Where bulk-density correction had not been applied, we tried to make those corrections to estimate changes to equivalent soil mass if studies provided sufficient information on soil bulk density and depth, using the method of Zhang et al. (2004). If that was not possible, we used the reported SOC, TN, or TP contents. <em><strong>Acknowledgements</strong></em> We thank scientists who measured, analyzed, and published the data compiled for this study. We are especially grateful to Drs. Axel Don, Christopher Poeplau, Lex Bouwman, and Gaihe Yang, who provided their global meta-data through personal communication. D.-G.K. acknowledges support from the IAEA CRP D15020. M.U.F.K and L.L.L. were supported by the Strategic Science Investment Fund (SSIF) of New Zealand\u2019s Ministry of Business, Innovation and Employment.", "keywords": ["2. Zero hunger", "13. Climate action", "land-use change", " greenhouse gas emissions", " soil", " carbon", " nitrogen", " phosphorus", " stoichiometry", " time", " temperature", " rainfall", " forest type", "15. Life on land"]}, "links": [{"href": "https://doi.org/10.5281/zenodo.7656722"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.7656722", "name": "item", "description": "10.5281/zenodo.7656722", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.7656722"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-02-20T00:00:00Z"}}, {"id": "10.5061/dryad.0gb5mkkwr", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:22:10Z", "type": "Dataset", "title": "Data from: Soil carbon, nitrogen and phosphorus stoichiometry (C:N:P) in relation to conifer species productivity and nutrition across British Columbia perhumid rainforests", "description": "Temperate rainforest soils of the Pacific Northwest are often carbon (C)  rich and encompass a wide range in fertility reflecting varying nitrogen  (N) and phosphorus (P) availability.\u00a0 Soil resource stoichiometry  (C:N:P) may provide an effective measure of site nutrient status and help  refine species-dependent patterns in forest productivity across edaphic  gradients.\u00a0 We determined mineral soil and forest floor nutrient  concentrations across very wet (perhumid) rainforest sites of southwestern  Vancouver Island (Canada), and employed soil element ratios as covariates  in a long-term planting density trial to test their utility in defining  basal area growth response of four conifer species.\u00a0 There were  strong positive correlations in mineral soil C, N and organic P (Po)  concentrations, and close alignment in C:N and C:Po both among and between  substrates.\u00a0 Stand basal area after five decades was best  reflected by mineral soil and forest floor C:N but in either case included  a significant species-soil interaction.\u00a0 The conifers with  ectomycorrhizal fungi had diverging growth responses displaying either  competitive (Picea sitchensis) or stress-tolerant (Tsuga heterophylla,  Pseudotsuga menziesii) attributes, in contrast to a more generalist  response by an arbuscular mycorrhizal tree (Thuja plicata).\u00a0  Despite the consistent patterns in organic matter quality we found no  evidence for increased foliar P concentrations with declining element  ratios (C:Po or C:Ptotal) as we did for N.\u00a0 The often high C:Po  ratios (as much as 3000) of these soils may reflect a stronger  immobilization sink for P than N, which, along with ongoing sorption of  PO4-, could limit the utility of C:Po or N:Po to adequately reflect P  supply.\u00a0 The dynamics and availability of soil P to trees,  particularly as Po, deserves greater attention as many perhumid  rainforests were co-limited by N and P, or, in some stands, possibly P  alone.", "keywords": ["Conifers", "Canada", "British Columbia", "C:N:P stoichiometry", "15. Life on land", "Soil carbon"], "contacts": [{"organization": "Kranabetter, John Marty, Sholinder, Ariana, de Montigny, Louise,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.0gb5mkkwr"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.0gb5mkkwr", "name": "item", "description": "10.5061/dryad.0gb5mkkwr", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.0gb5mkkwr"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-10-25T00:00:00Z"}}, {"id": "10.1007/s10533-015-0169-1", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:15:20Z", "type": "Journal Article", "created": "2015-12-09", "title": "Elevated Co2 Increased Phosphorous Loss From Decomposing Litter And Soil Organic Matter At Two Face Experiments With Trees", "description": "Sustained increased productivity of trees growing in elevated CO2 depends in part on their stoichiometric flexibility, i.e., increasing their nutrient use efficiency, or on increased nutrient uptake from the soil. Phosphorus (P) may be a nutrient as limiting as nitrogen (N) in terrestrial ecosystems and may play a key-process in global terrestrial C storage. For this study archived litter and soil samples of two free air CO2 enrichment (FACE) experiments were analyzed for C, N and P. Populus euramericana, nigra and alba and Betula pendula, Alnus glutinosa and Fagus sylvatica were grown in ambient and elevated CO2 at respectively the Euro- and BangorFACE experiments. At EuroFACE, aboveground litter accumulated in L, F and H layers, while at BangorFACE almost all aboveground litter was incorporated into the mineral soil due to bioturbation. At EuroFACE, more P was lost from the F and H litter layers due to trees growing in elevated CO2, while at BangorFACE more P was lost from the mineral soil. Results of this study imply that trees growing in elevated CO2 were P limited at both experiments. Therefore, with increasing atmospheric CO2, P may play a more pronounced role than previous thought in regulating secondary forest growth. Moreover, increased atmospheric CO2 and ample N may allow a larger pool of P to become available for uptake due to, for instance, increased phosphatase activity resulting in increased organic matter turnover and biogenic weathering. Therefore, it may be postulated that under non-N-limited conditions, e.g., during regrowth, under high N deposition or in systems with high N2-fixation, increased P availability and uptake may allow P-limited forests to sustain increased growth under increasing atmospheric CO2.", "keywords": ["0106 biological sciences", "4. Education", "Litter and soil stoichiometry", "04 agricultural and veterinary sciences", "15. Life on land", "Soil phosphorous", "01 natural sciences", "Secondary forest growth", "13. Climate action", "Elevated CO", "Environmental Chemistry", "0401 agriculture", " forestry", " and fisheries", "FACE experiment", "Earth-Surface Processes", "Water Science and Technology"], "contacts": [{"organization": "Hoosbeek, Marcel R.", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1007/s10533-015-0169-1"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biogeochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s10533-015-0169-1", "name": "item", "description": "10.1007/s10533-015-0169-1", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s10533-015-0169-1"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2015-12-08T00:00:00Z"}}, {"id": "10.1007/s10533-011-9695-7", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:15:19Z", "type": "Journal Article", "created": "2012-01-06", "title": "Tree Species Effects On Coupled Cycles Of Carbon, Nitrogen, And Acidity In Mineral Soils At A Common Garden Experiment", "description": "Forest biogeochemical cycles are shaped by effects of dominant tree species on soils, but the underlying mechanisms are not well understood. We investigated effects of temperate tree species on interactions among carbon (C), nitrogen (N), and acidity in mineral soils from an experiment with replicated monocultures of 14 tree species. To identify how trees affected these soil properties, we evaluated correlations among species-level characteristics (e.g. nutrient concentrations in leaf litter, wood, and roots), stand-level properties (e.g. nutrient fluxes through leaf litterfall, nutrient pools in stemwood), and components of soil C, N, and cation cycles. Total extractable acidity (aciditytot) was correlated positively with mineral soil C stocks (R2 = 0.72, P < 0.001), such that a nearly two-fold increase in aciditytot was associated with a more than two-fold increase of organic C. We attribute this correlation to effects of tree species on soil acidification and subsequent mineral weathering reactions, which make hydrolyzing cations available for stabilization of soil organic matter. The effects of tree species on soil acidity were better understood by measuring multiple components of soil acidity, including pH, the abundance of hydrolyzing cations in soil solutions and on cation exchange sites, and aciditytot. Soil pH and aciditytot were correlated with proton-producing components of the soil N cycle (e.g. nitrification), which were positively correlated with species-level variability in fine root N concentrations. Soluble components of soil acidity, such as aluminum in saturated paste extracts, were more strongly related to plant traits associated with calcium cycling, including leaf and root calcium concentrations. Our results suggest conceptual models of plant impacts on soil biogeochemistry should be revised to account for underappreciated plant traits and biogeochemical processes.", "keywords": ["0106 biological sciences", "2. Zero hunger", "13. Climate action", "XXXXXX - Unknown", "weathering", "0401 agriculture", " forestry", " and fisheries", "04 agricultural and veterinary sciences", "humus", "15. Life on land", "cations", "01 natural sciences", "stoichiometry", "wood"]}, "links": [{"href": "https://doi.org/10.1007/s10533-011-9695-7"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biogeochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s10533-011-9695-7", "name": "item", "description": "10.1007/s10533-011-9695-7", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s10533-011-9695-7"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2012-01-06T00:00:00Z"}}, {"id": "10.1007/s11104-016-2995-x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:15:36Z", "type": "Journal Article", "created": "2016-07-26", "title": "Prescribed Fire Alters Foliar Stoichiometry And Nutrient Resorption In The Understorey Of A Subtropical Eucalypt Forest", "description": "Changes to soil nutrient concentrations following vegetation fire may affect biogeochemical cycling and foliar stoichiometry. Phosphorus (P)-limited plant communities are widespread and may be particularly sensitive to fire, but have received relatively little research attention in this context. We measured soil nutrient concentrations, foliar carbon (C), nitrogen (N) and P stoichiometry of understorey plants in a recently, frequently burned eucalyptus forest area in south-east Queensland, Australia, and compared these properties to an adjacent unburned area. Surface soils in the area subjected to relatively recent, frequent prescribed burning had higher P concentrations than those in the adjacent unburned area, although this did not include the \u2018available\u2019 forms of P. All plant species had high foliar N:P ratios, regardless of fire history, consistent with widespread P-limitation. Some species had lower foliar N:P ratios in the burned area, indicating interspecific variation in nutrient requirements and burning responses. The nutrient resorption proficiencies of a grasstree (Xanthorrhoea johnsonii Lee) were lower in the burned area, suggesting that the nutrient cycling of this species was made less conservative by burning. The stoichiometric patterns observed in the responses of plants to prescribed burning highlight the significance of fire in this P-impoverished plant community, and suggest the potential value of stoichiometric approaches in fire ecology.", "keywords": ["580", "Agricultural", "ecological stoichiometry", "Forest meteorology. Forest microclimatology", "FoR 07 (Agricultural and Veterinary Sciences)", "phosphorus limitation", "04 agricultural and veterinary sciences", "15. Life on land", "Environmental sciences", "fire ecology", "Biological sciences", "Research. Experimentation", "veterinary and food sciences", "0401 agriculture", " forestry", " and fisheries", "Soils. Soil science", "Other environmental sciences not elsewhere classified", "FoR 05 (Environmental Sciences)", "FoR 06 (Biological Sciences)", "forest fire"]}, "links": [{"href": "https://doi.org/10.1007/s11104-016-2995-x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Plant%20and%20Soil", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s11104-016-2995-x", "name": "item", "description": "10.1007/s11104-016-2995-x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s11104-016-2995-x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2016-07-26T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2016.03.008", "type": "Feature", "geometry": null, "properties": {"license": "Closed Access", "updated": "2026-06-23T16:17:39Z", "type": "Journal Article", "created": "2016-03-26", "title": "Soil microbial carbon use efficiency and biomass turnover in a long-term fertilization experiment in a temperate grassland", "description": "<p>Soil microbial carbon use efficiency (CUE), defined as the ratio of organic C allocated to growth over organic C taken up, strongly affects soil carbon (C) cycling. Despite the importance of the microbial CUE for the terrestrial C cycle, very little is known about how it is affected by nutrient availability. Therefore, we studied microbial CUE and microbial biomass turnover time in soils of a long-term fertilization experiment in a temperate grassland comprising five treatments (control, PK, NK, NP, NPK). Microbial CUE and the turnover of microbial biomass were determined using a novel substrate-independent method based on incorporation of <sup>18</sup>O from labeled water into microbial DNA. Microbial respiration was 28-37% smaller in all three N treatments (NK, NP, and NPK) compared to the control, whereas the PK treatment did not affect microbial respiration. N-fertilization decreased microbial C uptake, while the microbial growth rate was not affected. Microbial CUE ranged between 0.31 and 0.45, and was 1.3- to 1.4-fold higher in the N-fertilized soils than in the control. The turnover time ranged between 80 and 113 days and was not significantly affected by fertilization. Net primary production (NPP) and the abundance of legumes differed strongly across the treatments, and the fungal:bacterial ratio was very low in all treatments. Structural equation modeling revealed that microbial CUE was exclusively controlled by N fertilization and that neither the abundance of legumes (as a proxy for the quality of the organic matter inputs) nor NPP (as a proxy for C inputs) had an effect on microbial CUE. Our results show that N fertilization did not only decrease microbial respiration, but also microbial C uptake, indicating that less C was intracellularly processed in the N fertilized soils. The reason for reduced C uptake and increased CUE in the N-fertilization treatments is likely an inhibition of oxidative enzymes involved in the degradation of aromatic compounds by N in combination with a reduced energy requirement for microbial N acquisition in the fertilized soils. In conclusion, the study shows that N availability can control soil C cycling by affecting microbial CUE, while plant community-mediated changes in organic matter inputs and P and K availability played no important role for C partitioning of the microbial community in this temperate grassland. </p>", "keywords": ["FUNGAL", "2. Zero hunger", "106022 Mikrobiologie", "Nitrogen addition", "BACTERIAL", "NITROGEN DEPOSITION", "GROWTH EFFICIENCY", "FOREST FLOOR", "Nutrients", "04 agricultural and veterinary sciences", "15. Life on land", "Stoichiometry", "ORGANIC-MATTER", "RESPIRATION", "106026 \u00d6kosystemforschung", "13. Climate action", "Nutrient limitation", "Microbial growth yield", "106022 Microbiology", "0401 agriculture", " forestry", " and fisheries", "Mean residence time", "STOICHIOMETRIC CONTROLS", "ENZYME-ACTIVITY", "106026 Ecosystem research", "COMMUNITY STRUCTURE"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2016.03.008"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2016.03.008", "name": "item", "description": "10.1016/j.soilbio.2016.03.008", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2016.03.008"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2016-06-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2016.07.003", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:17:39Z", "type": "Journal Article", "created": "2016-07-08", "title": "Soil extracellular enzyme activities, soil carbon and nitrogen storage under nitrogen fertilization: A meta-analysis", "description": "Abstract   Nitrogen (N) fertilization affects the rate of soil organic carbon (SOC) decomposition by regulating extracellular enzyme activities (EEA). Extracellular enzymes have not been represented in global biogeochemical models. Understanding the relationships among EEA and SOC, soil N (TN), and soil microbial biomass carbon (MBC) under N fertilization would enable modeling of the influence of EEA on SOC decomposition. Based on 65 published studies, we synthesized the activities of \u03b1-1,4-glucosidase (AG), \u03b2-1,4-glucosidase (BG), \u03b2- d -cellobiosidase (CBH), \u03b2-1,4-xylosidase (BX), \u03b2-1,4-N-acetyl-glucosaminidase (NAG), leucine amino peptidase (LAP), urease (UREA), acid phosphatase (AP), phenol oxidase (PHO), and peroxidase (PEO) in response to N fertilization. The proxy variables for hydrolytic C acquisition enzymes (C-acq), N acquisition (N-acq), and oxidative decomposition (OX) were calculated as the sum of AG, BG, CBH and BX; AG and LAP; PHO and PEO, respectively. The relationships between response ratios (RRs) of EEA and SOC, TN, or MBC were explored when they were reported simultaneously. Results showed that N fertilization significantly increased CBH, C-acq, AP, BX, BG, AG, and UREA activities by 6.4, 9.1, 10.6, 11.0, 11.2, 12.0, and 18.6%, but decreased PEO, OX and PHO by 6.1, 7.9 and 11.1%, respectively. N fertilization enhanced SOC and TN by 7.6% and 15.3%, respectively, but inhibited MBC by 9.5%. Significant positive correlations were found only between the RRs of C-acq and MBC, suggesting that changes in combined hydrolase activities might act as a proxy for MBC under N fertilization. In contrast with other variables, the RRs of AP, MBC, and TN showed unidirectional trends under different edaphic, environmental, and physiological conditions. Our results provide the first comprehensive set of evidence of how hydrolase and oxidase activities respond to N fertilization in various ecosystems. Future large-scale model projections could incorporate the observed relationship between hydrolases and microbial biomass as a proxy for C acquisition under global N enrichment scenarios in different ecosystems.", "keywords": ["LITTER", "570", "Science & Technology", "MICROBIAL COMMUNITY", "Microbial Biomass Carbon (Mbc)", "Soil Science", "610", "Agriculture", "04 agricultural and veterinary sciences", "15. Life on land", "FOREST", "Meta-analysis", "Nitrogen Fertilization", "METHANE OXIDATION", "ECOSYSTEM", "0401 agriculture", " forestry", " and fisheries", "Soil Organic Carbon (Soc)", "ECOENZYMATIC STOICHIOMETRY", "DEPOSITION", "ELEVATED CO2", "Life Sciences & Biomedicine", "Extracellular Enzyme Activities (Eea)", "GLOBAL PERSPECTIVE", "RESPONSES"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2016.07.003"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2016.07.003", "name": "item", "description": "10.1016/j.soilbio.2016.07.003", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2016.07.003"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2016-10-01T00:00:00Z"}}, {"id": "10.1016/j.scitotenv.2008.11.046", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:17:20Z", "type": "Journal Article", "created": "2008-12-20", "title": "How Nitrogen And Sulphur Addition, And A Single Drought Event Affect Root Phosphatase Activity In Phalaris Arundinacea", "description": "Conservation and restoration of fens and fen meadows often aim to reduce soil nutrients, mainly nitrogen (N) and phosphorus (P). The biogeochemistry of P has received much attention as P-enrichment is expected to negatively impact on species diversity in wetlands. It is known that N, sulphur (S) and hydrological conditions affect the biogeochemistry of P, yet their interactive effects on P-dynamics are largely unknown. Additionally, in Europe, climate change has been predicted to lead to increases in summer drought. We performed a greenhouse experiment to elucidate the interactive effects of N, S and a single drought event on the P-availability for Phalaris arundinacea. Additionally, the response of plant phosphatase activity to these factors was measured over the two year experimental period. In contrast to results from earlier experiments, our treatments hardly affected soil P-availability. This may be explained by the higher pH in our soils, hampering the formation of Fe-P or Fe-Al complexes. Addition of S, however, decreased the plants N:P ratio, indicating an effect of S on the N:P stoichiometry and an effect on the plant's P-demand. Phosphatase activity increased significantly after addition of S, but was not affected by the addition of N or a single drought event. Root phosphatase activity was also positively related to plant tissue N and P concentrations, plant N and P uptake, and plant aboveground biomass, suggesting that the phosphatase enzyme influences P-biogeochemistry. Our results demonstrated that it is difficult to predict the effects of wetland restoration, since the involved mechanisms are not fully understood. Short-term and long-term effects on root phosphatase activity may differ considerably. Additionally, the addition of S can lead to unexpected effects on the biogeochemistry of P. Our results showed that natural resource managers should be careful when restoring degraded fens or preventing desiccation of fen ecosystems.", "keywords": ["summer", "0106 biological sciences", "plant tissue", "550", "Sulphate induced enzyme activity", "phosphorus limitation", "plant", "sulfate", "drought", "deposition", "Plant Roots", "01 natural sciences", "nitrogen", "iron", "biogeochemistry", "Root-surface phosphatase", "SDG 13 - Climate Action", "Phalaris", "species richness", "phosphorus", "N:P stoichiometry", "manager", "Plant Proteins", "2. Zero hunger", "pH", "grasslands", "Phosphorus", "dynamics", "04 agricultural and veterinary sciences", "wetland", "6. Clean water", "enzyme activity", "stoichiometry", "Europe", "eutrophication", "climate change", "Nitrogen", "growth", "fresh-water wetlands", "phosphatase", "soil", "desiccation", "Stress", " Physiological", "N:P ratios", "greenhouse", "N:P rations", "Fertilizers", "580", "Phosphorus uptake", "ecosystem", "biomass", "species diversity", "carbon", "nutrient", "15. Life on land", "Phosphoric Monoester Hydrolases", "enzyme", "fertilization", "13. Climate action", "Wetlands", "sulfur", "0401 agriculture", " forestry", " and fisheries", "Sulfur"]}, "links": [{"href": "https://doi.org/10.1016/j.scitotenv.2008.11.046"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Science%20of%20The%20Total%20Environment", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.scitotenv.2008.11.046", "name": "item", "description": "10.1016/j.scitotenv.2008.11.046", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.scitotenv.2008.11.046"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2009-03-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2010.09.017", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:17:34Z", "type": "Journal Article", "created": "2010-09-29", "title": "Fungi Mediate Long Term Sequestration Of Carbon And Nitrogen In Soil Through Their Priming Effect", "description": "It is increasingly recognized that soil microbes have the ability to decompose old recalcitrant soil organic matter (SOM) by using fresh carbon as a source of energy, a phenomena called priming effect (PE). However, efforts to determine the consequences of this PE for soil carbon and nitrogen dynamics are in their early stage. Moreover, little is known about the microbial populations involved. Here we explore the consequences of PE for SOM dynamics and mineral nitrogen availability in a soil incubation experiment (161 days), combining the supply of dual-labeled (13C and 14C) cellulose and mineral nutrients. The microbial groups involved in PE were investigated using molecular fingerprinting techniques (FAMEs and B- and F-ARISA). We show that mean residence time of SOM pool controlled by the PE decreased from 3130 years in the subsoil, where the availability of fresh carbon is very low, to 17\u201339 years in the surface layer. This result suggests that the decomposition of this recalcitrant soil C pool is strictly dependent on the presence of fresh C and is not an energetically viable mean of accessing C for soil microbes. We also suggest that fungi are the predominant actors of cellulose decomposition and induced PE and they adjust their degradation activity to nutrient availability. The predominant role of fungi can be explained by their ability to grow as mycelium which allows them to explore soil space and mine large reserve of SOM. Finally, our results support the existence of a bank mechanism that regulates nutrient and carbon sequestration in soil: PE is low when nutrient availability is high, allowing sequestration of nutrients and carbon; in contrast, microbes release nutrients from SOM when nutrient availability is low. This bank mechanism may help to synchronize the availability of soluble nutrients to plant requirement and contribute to long-term SOM accumulation in ecosystems.", "keywords": ["2. Zero hunger", "570", "550", "FUNGI", "04 agricultural and veterinary sciences", "[SDV.SA.SDS]Life Sciences [q-bio]/Agricultural sciences/Soil study", "15. Life on land", "CELLULOTYC MICROBES", "STOICHIOMETRY", "01 natural sciences", "NITROGEN CYCLING", "CARBON SEQUESTRATION", "PRIMING EFFECT", "13. Climate action", "MICROBIAL ECOLOGY", "SOIL FERTILITY", "0401 agriculture", " forestry", " and fisheries", "EFFET D'AMOR\u00c7AGE", "[SDV.SA.SDS] Life Sciences [q-bio]/Agricultural sciences/Soil study", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2010.09.017"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2010.09.017", "name": "item", "description": "10.1016/j.soilbio.2010.09.017", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2010.09.017"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2011-01-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2014.11.003", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:17:37Z", "type": "Journal Article", "created": "2014-11-17", "title": "Short- And Long-Term Effects Of Nutrient Enrichment On Microbial Exoenzyme Activity In Mangrove Peat", "description": "Abstract Mangroves receive increasing quantities of nutrients as a result of coastal development, which could lead to significant changes in carbon sequestration and soil subsidence. We hypothesised that mangrove-produced tannins induce a nitrogen (N) limitation on microbial decomposition even when plant growth is limited by phosphorus (P). As a result, increased N influx would lead to a net loss of sequestered carbon negating the ability to compensate for sea level rise in P-limited mangroves. To examine this, we quantified the short- and long-term effects of N and P enrichment on microbial biomass and decomposition-related enzyme activities in a Rhizophora mangle-dominated mangrove, which had been subjected to fertilisation treatments for a period of fifteen years. We compared microbial biomass, elemental stoichiometry and potential enzyme activity in dwarf and fringe-type R. mangle-dominated sites, where primary production is limited by P or N depending on the proximity to open water. Even in P-limited mangroves, microbial activity was N-limited as indicated by stoichiometry and an increase in enzymic activity upon N amendment. Nevertheless, microbial biomass increased upon field additions of P, indicating that the carbon supply played even a larger role. Furthermore, we found that P amendment suppressed phenol oxidase activity, while N amendment did not. The possible differential nutrient limitations of microbial decomposers versus primary producers implies that the direction of the effect of eutrophication on carbon sequestration is nutrient-specific. In addition, this study shows that phenol oxidase activities in this system decrease through P, possibly strengthening the enzymic latch effect of mangrove tannins. Furthermore, it is argued that the often used division between N-harvesting, P-harvesting, and carbon-harvesting exoenzymes needs to be reconsidered.", "keywords": ["Rhizophora", "Decomposition", "Peat", "Differential nutrient limitation", "04 agricultural and veterinary sciences", "15. Life on land", "01 natural sciences", "Microbial activity", "Microbial elemental stoichiometry", "13. Climate action", "international", "Taverne", "11. Sustainability", "Mangroves", "0401 agriculture", " forestry", " and fisheries", "SDG 14 - Life Below Water", "SOC", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2014.11.003"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2014.11.003", "name": "item", "description": "10.1016/j.soilbio.2014.11.003", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2014.11.003"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2015-02-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2014.04.001", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:17:37Z", "type": "Journal Article", "created": "2014-04-18", "title": "Increase In Microbial Biomass And Phosphorus Availability In The Rhizosphere Of Intercropped Cereal And Legumes Under Field Conditions", "description": "Abstract   Facilitation of plant growth and phosphorus (P) acquisition has recently been reported in cereal\u2013legume intercropping systems. The aim of this study was to test the hypothesis that intercropping could promote P cycling, through microbial biomass P (MBP) changes, in a field trial in a Mediterranean climate. Changes in microbial biomass carbon (MBC), MBP, and inorganic P availability in the rhizosphere of intercropped species were thus investigated in durum wheat/chickpea and durum wheat/lentil intercrops and compared to the bulk soils as well as the rhizosphere of each species grown alone. When expressed relative to the bulk soil, MBC increased in the rhizosphere only for the intercropped plants, irrespective of species. Relative to MBC in the rhizosphere of sole crops, MBC increased in the rhizosphere of the two legume species when intercropped with durum wheat, while no such effect was found for durum wheat. We were unable to detect an increase in P availability in the rhizosphere as a response to intercropping in any of the three crop species, but there was a systematic increase in available P in the rhizosphere relative to the corresponding bulk soil. Fairly similar patterns were observed for MBP as for MBC, except within the rhizosphere of durum wheat when intercropped with chickpea: relative to the bulk soil, MBP increased in the rhizosphere of both lentil and chickpea when intercropped with durum wheat as well as in the rhizosphere of durum wheat when intercropped with chickpea. The differences in microbial biomass changes for a given cereal (durum wheat) when intercropped with two different legumes, suggest that plants have strong species-specific influences on each other as well as on the soil environment. The molar ratios of MBC to MBP (MM C:P) did not vary significantly except for the rhizosphere of durum wheat intercropped with chickpea, which was fairly low (16:1), about half the values found in the other treatments (26\u201340:1). These MM C:P values were lower than those generally reported in soils (38\u201360:1), verifying the hypothesis that microbes can increase storage of soil P in their biomass, creating stocks of microbial P in the soil when P availability is high. In this Mediterranean climate where surface soils undergo frequent drying-rewetting, known for liberation of microbial biomass, MBP could be an important factor influencing P availability. Together, our data demonstrate the importance of intercropping to soil P cycling and highlight the need to examine the rhizosphere of each intercropped species to truly understand how the soil P resource is shared in such agroecosystems.", "keywords": ["[SDV.SA]Life Sciences [q-bio]/Agricultural sciences", "0301 basic medicine", "570", "F08 - Syst\u00e8mes et modes de culture", "[SDV.SA.AGRO]Life Sciences [q-bio]/Agricultural sciences/Agronomy", "Microbial biomass", "F62 - Physiologie v\u00e9g\u00e9tale - Croissance et d\u00e9veloppement", "630", "03 medical and health sciences", "[SDV.EE]Life Sciences [q-bio]/Ecology", "http://aims.fao.org/aos/agrovoc/c_3081", "580", "[SDV.SA.AGRO] Life Sciences [q-bio]/Agricultural sciences/Agronomy", "2. Zero hunger", "[SDV.SA] Life Sciences [q-bio]/Agricultural sciences", "P availability", "P34 - Biologie du sol", "04 agricultural and veterinary sciences", "15. Life on land", "Stoichiometry", "http://aims.fao.org/aos/agrovoc/c_4188", "[SDV.EE] Life Sciences [q-bio]/Ecology", " environment", "Intercropping", "0401 agriculture", " forestry", " and fisheries", "Facilitation", "environment"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2014.04.001"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2014.04.001", "name": "item", "description": "10.1016/j.soilbio.2014.04.001", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2014.04.001"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2014-08-01T00:00:00Z"}}, {"id": "10.1890/12-1760.1", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:20:44Z", "type": "Journal Article", "created": "2013-07-09", "title": "Earthworm Effects On The Incorporation Of Litter C And N Into Soil Organic Matter In A Sugar Maple Forest", "description": "<p>To examine the mechanisms of earthworm effects on forest soil C and N, we double\uffe2\uff80\uff90labeled leaf litter with13C and15N, applied it to sugar maple forest plots with and without earthworms, and traced isotopes into soil pools. The experimental design included forest plots with different earthworm community composition (dominated byLumbricus terrestrisorL. rubellus). Soil carbon pools were 37% lower in earthworm\uffe2\uff80\uff90invaded plots largely because of the elimination of the forest floor horizons, and mineral soil C:N was lower in earthworm plots despite the mixing of high C:N organic matter into soil by earthworms. Litter disappearance over the first winter\uffe2\uff80\uff93spring was highest in theL. terrestris(T) plots, but during the warm season, rapid loss of litter was observed in bothL. rubellus(R) and T plots. After two years, 22.0% \uffc2\uffb1 5.4% of13C released from litter was recovered in soil with no significant differences among plots. Total recovery of added13C (decaying litter plus soil) was much higher in no\uffe2\uff80\uff90worm (NW) plots (61\uffe2\uff80\uff9368%) than in R and T plots (20\uffe2\uff80\uff9329%) as much of the litter remained in the former whereas it had disappeared in the latter. Much higher percentage recovery of15N than13C was observed, with significantly lower values for T than R and NW plots. Higher overwinter earthworm activity in T plots contributed to lower soil N recovery. In earthworm\uffe2\uff80\uff90invaded plots isotope enrichment was highest in macroaggregates and microaggregates whereas in NW plots silt plus clay fractions were most enriched. The net effect of litter mixing and priming of recalcitrant soil organic matter (SOM), stabilization of SOM in soil aggregates, and alteration of the soil microbial community by earthworm activity results in loss of SOM and lowering of the C:N ratio. We suggest that earthworm stoichiometry plays a fundamental role in regulating C and N dynamics of forest SOM.</p>", "keywords": ["Time Factors", "Nitrogen", "TEMPERATE HARDWOOD FOREST", "New York", "Acer", "C:N ratio", "Trees", "OLD-GROWTH FOREST", "Soil", "litter", "EXOTIC EARTHWORMS", "Animals", "NORTHEASTERN FORESTS", "Oligochaeta", "CARBON DYNAMICS", "Ecosystem", "2. Zero hunger", "decomposition", "NITROGEN DEPOSITION", "Ecology", "Lumbricus", "MICROBIAL BIOMASS", "04 agricultural and veterinary sciences", "15. Life on land", "DECIDUOUS FOREST", "Carbon", "stoichiometry", "aggregate", "0401 agriculture", " forestry", " and fisheries", "LUMBRICUS-TERRESTRIS", "Environmental Sciences", "CENTRAL NEW-YORK", "Environmental Monitoring"]}, "links": [{"href": "https://doi.org/10.1890/12-1760.1"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecological%20Applications", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1890/12-1760.1", "name": "item", "description": "10.1890/12-1760.1", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1890/12-1760.1"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2013-07-01T00:00:00Z"}}, {"id": "10.1016/j.tree.2017.12.007", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:17:55Z", "type": "Journal Article", "created": "2018-01-08", "title": "Energy Flux: The Link between Multitrophic Biodiversity and Ecosystem Functioning", "description": "Relating biodiversity to ecosystem functioning in natural communities has become a paramount challenge as links between trophic complexity and multiple ecosystem functions become increasingly apparent. Yet, there is still no generalised approach to address such complexity in biodiversity-ecosystem functioning (BEF) studies. Energy flux dynamics in ecological networks provide the theoretical underpinning of multitrophic BEF relationships. Accordingly, we propose the quantification of energy fluxes in food webs as a powerful, universal tool for understanding ecosystem functioning in multitrophic systems spanning different ecological scales. Although the concept of energy flux in food webs is not novel, its application to BEF research remains virtually untapped, providing a framework to foster new discoveries into the determinants of ecosystem functioning in complex systems.", "keywords": ["0106 biological sciences", "0301 basic medicine", "ecological stoichiometry", "Food Chain", "food web", "interaction network", "Biodiversity", "15. Life on land", "metabolic theory", "Models", " Biological", "01 natural sciences", "630", "004", "trophic cascade", "03 medical and health sciences", "13. Climate action", "ecosystem multifunctionality", "Ecosystem"]}, "links": [{"href": "https://doi.org/10.1016/j.tree.2017.12.007"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Trends%20in%20Ecology%20%26amp%3B%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.tree.2017.12.007", "name": "item", "description": "10.1016/j.tree.2017.12.007", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.tree.2017.12.007"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-03-01T00:00:00Z"}}, {"id": "10.1023/a:1017922715903", "type": "Feature", "geometry": null, "properties": {"license": "Restricted", "updated": "2026-06-23T16:18:11Z", "type": "Journal Article", "description": "Conservation management in meadows often focuses on reducing soil fertility and consequently community productivity as to promote and sustain species-rich vegetations. The productivity level to which nutrients are limiting growth is, however, unclear, as well as the relationship between productivity and the type of nutrient limitation. We carried out a fertilization experiment with N, P and K in six annually mown meadows along an aerial phytomass gradient (200\u2013650 g m\u22122). All meadows were found to be growth-limited by nutrients. Low-productive meadows were N-limited, or N+P co-limited, whereas our higher productive meadows were co-limited by a combination of N, P and/or K. The results from our experiments were compared with the results from 45 other fertilization experiments with N, P and K in grasslands and wetlands (aerial phytomass range 50\u20131500 g m\u22122). Our results were consistent in nitrogen being the most frequent (co)-limiting nutrient, and regarding the equal frequence of occurrence of P (co)-limitation and K (co)-limitation (both in ca. 25\u201330% of all sites). Co-limitation occurred more often in our sites than in the other experiments. There was no clear relationship between aerial phytomass and type of nutrient limitation, except that K (co)-limitation only occurred at sites with phytomass above 200 g m\u22122, and P (co)-limitation below 600 g m\u22122. A comparison of productivity and nutrient concentrations in aerial phytomass among two years indicated that the type of nutrient limitation is not a static site characteristic but may vary with dynamic environmental conditions such as soil wetness; drought seems to enhance N-availability which may induce P- and K-limitation.", "keywords": ["N:P stoichiometry"]}, "links": [{"href": "https://doi.org/10.1023/a:1017922715903"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Plant%20and%20Soil", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1023/a:1017922715903", "name": "item", "description": "10.1023/a:1017922715903", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1023/a:1017922715903"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2001-01-01T00:00:00Z"}}, {"id": "10.1111/gcb.15218", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:19:26Z", "type": "Journal Article", "created": "2020-06-12", "title": "Long\u2010term nitrogen loading alleviates phosphorus limitation in terrestrial ecosystems", "description": "Abstract<p>Increased human\uffe2\uff80\uff90derived nitrogen (N) deposition to terrestrial ecosystems has resulted in widespread phosphorus (P) limitation of net primary productivity. However, it remains unclear if and how N\uffe2\uff80\uff90induced P limitation varies over time. Soil extracellular phosphatases catalyze the hydrolysis of P from soil organic matter, an important adaptive mechanism for ecosystems to cope with N\uffe2\uff80\uff90induced P limitation. Here we show, using a meta\uffe2\uff80\uff90analysis of 140 studies and 668 observations worldwide, that N stimulation of soil phosphatase activity diminishes over time. Whereas short\uffe2\uff80\uff90term N loading (\uffe2\uff89\uffa45\uffc2\uffa0years) significantly increased soil phosphatase activity by 28%, long\uffe2\uff80\uff90term N loading had no significant effect. Nitrogen loading did not affect soil available P and total P content in either short\uffe2\uff80\uff90 or long\uffe2\uff80\uff90term studies. Together, these results suggest that N\uffe2\uff80\uff90induced P limitation in ecosystems is alleviated in the long\uffe2\uff80\uff90term through the initial stimulation of soil phosphatase activity, thereby securing P supply to support plant growth. Our results suggest that increases in terrestrial carbon uptake due to ongoing anthropogenic N loading may be greater than previously thought.</p", "keywords": ["Nitrogen", "Microbial biomass", "phosphorus limitation", "Phosphorus limitation", "Soil pH", "nitrogen addition", "Soil phosphorus content", "soil pH", "Soil phosphatase activity", "Soil", "Soil nitrogen content", "soil nitrogen content", "Humans", "Biomass", "Ecosystem", "2. Zero hunger", "Nitrogen addition", "microbial biomass", "nutrient stoichiometry balance", "Phosphorus", "04 agricultural and veterinary sciences", "Ecolog\u00eda", "15. Life on land", "Carbon", "soil phosphatase activity", "soil phosphorus content", "Nutrient stoichiometry balance", "13. Climate action", "0401 agriculture", " forestry", " and fisheries"]}, "links": [{"href": "https://onlinelibrary.wiley.com/doi/pdf/10.1111/gcb.15218"}, {"href": "https://doi.org/10.1111/gcb.15218"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Global%20Change%20Biology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/gcb.15218", "name": "item", "description": "10.1111/gcb.15218", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/gcb.15218"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-07-01T00:00:00Z"}}, {"id": "10.1111/een.12679", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:19:21Z", "type": "Journal Article", "created": "2018-10-05", "title": "Ecological stoichiometry and nutrient partitioning in two insect herbivores responsible for large\u2010scale forest disturbance in the Fennoscandian subarctic", "description": "<p>1. Outbreaks of herbivorous insects can have large impacts on regional soil carbon (C) storage and nutrient cycling. In northernmost Europe, population outbreaks of several geometrid moth species regularly cause large\uffe2\uff80\uff90scale defoliation in subarctic birch forests. An improved understanding is required of how leaf C and nutrients are processed after ingestion by herbivores and what this means for the quantity and quality of different materials produced (frass, bodies).</p><p>2. In this study, larvae of two geometrid species responsible for major outbreaks (Epirrita autumnata and Operophtera brumata) were raised on exclusive diets of Betula pubescens var. czerepanovii (N. I. Orlova) H\uffc3\uffa4met Ahti and two other abundant understorey species (Betula nana, Vaccinium myrtillus). The quantities of C, nitrogen (N) and phosphorus (P) ingested and allocated to frass, bodies and (in the case of C) respired were recorded.</p><p>3. Overall, 23%, 70% and 48% of ingested C, N and P were allocated to bodies, respectively, rather than frass and (in the case of C) respiration. Operophtera brumata consistently maintained more constant body stoichiometric ratios of C, N and P than did E. autumnata, across the wide variation in physico\uffe2\uff80\uff90chemical properties of plant diet supplied.</p><p>4. These observed differences and similarities on C and nutrient processing may improve researchers' ability to predict the amount and stoichiometry of frass and bodies generated after geometrid outbreaks. </p", "keywords": ["2. Zero hunger", "VDP::Mathematics and natural science: 400::Zoology and botany: 480::Ecology: 488", "0106 biological sciences", "570", "ecological stoichiometry", "590", "subarctic birch forest", "15. Life on land", "geometrid moth", "01 natural sciences", "[SDE.BE] Environmental Sciences/Biodiversity and Ecology", "VDP::Matematikk og Naturvitenskap: 400::Zoologiske og botaniske fag: 480::\u00d8kologi: 488", "Consumer\u2010driven nutrient recycling", "13. Climate action", "[SDV.EE.ECO]Life Sciences [q-bio]/Ecology", "homeostasis", "[SDV.EE.ECO] Life Sciences [q-bio]/Ecology", " environment/Ecosystems", "stable isotope", "[SDE.BE]Environmental Sciences/Biodiversity and Ecology", "environment/Ecosystems"]}, "links": [{"href": "http://onlinelibrary.wiley.com/wol1/doi/10.1111/een.12679/fullpdf"}, {"href": "https://doi.org/10.1111/een.12679"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecological%20Entomology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/een.12679", "name": "item", "description": "10.1111/een.12679", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/een.12679"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-10-04T00:00:00Z"}}, {"id": "10.1111/ele.13632", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:19:24Z", "type": "Journal Article", "created": "2020-08-11", "title": "Soil fungal mycelia have unexpectedly flexible stoichiometric C:N and C:P ratios", "description": "Abstract<p>Soil ecological stoichiometry provides powerful theories to integrate the complex interplay of element cycling and microbial communities into biogeochemical models. One essential assumption is that microbes maintain stable C:N:P (carbon:nitrogen:phosphorus) ratios independent of resource supply, although such homeostatic regulations have rarely been assessed in individual microorganisms. Here, we report an unexpected high flexibility in C:N and C:P values of saprobic fungi along nutrient supply gradients, overall ranging between 7\uffe2\uff80\uff90126 and 20\uffe2\uff80\uff901488, respectively, questioning microbial homeostasis. Fungal N:P varied comparatively less due to simultaneous reductions in mycelial N and P contents. As a mechanism, internal recycling processes during mycelial growth and an overall reduced N and P uptake appear more relevant than element storage. The relationships among fungal stoichiometry and growth disappeared in more complex media. These findings affect our interpretation of stoichiometric imbalances among microbes and soils and are highly relevant for developing microbial soil organic carbon and nitrogen models.</p>", "keywords": ["saprobic fungi", "0106 biological sciences", "0301 basic medicine", "2. Zero hunger", "570", "fungal nutrient retranslocation", "Nitrogen", "nutrient limitations", "microbial carbon sequestration", "Phosphorus", "500 Naturwissenschaften und Mathematik::570 Biowissenschaften; Biologie::570 Biowissenschaften; Biologie", "15. Life on land", "01 natural sciences", "Carbon", "soil ecological stoichiometry", "Soil", "element homeostasis", "03 medical and health sciences", "13. Climate action", "mycelial growth", "C:N:P ratios", "Soil Microbiology"]}, "links": [{"href": "https://onlinelibrary.wiley.com/doi/pdf/10.1111/ele.13632"}, {"href": "https://doi.org/10.1111/ele.13632"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecology%20Letters", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/ele.13632", "name": "item", "description": "10.1111/ele.13632", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/ele.13632"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-08-11T00:00:00Z"}}, {"id": "10.1111/nph.18309", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:19:50Z", "type": "Journal Article", "created": "2022-06-15", "title": "Recent and ancient evolutionary events shaped plant elemental composition of edaphic endemics: a phylogeny\u2010wide analysis of Iberian gypsum plants", "description": "Summary<p><p>The analysis of plant elemental composition and the underlying factors affecting its variation are a current hot topic in ecology. Ecological adaptation to atypical soils may shift plant elemental composition. However, no previous studies have evaluated its relevance against other factors such as phylogeny, climate or individual soil conditions.</p><p>We evaluated the effect of the phylogeny, environment (climate, soil), and affinity to gypsum soils on the elemental composition of 83 taxa typical of Iberian gypsum ecosystems. We used a new statistical procedure (multiple phylogenetic variance decomposition, MPVD) to decompose total explained variance by different factors across all nodes in the phylogenetic tree of target species (covering 120\uffe2\uff80\uff89million\uffe2\uff80\uff89years of Angiosperm evolution).</p><p>Our results highlight the relevance of phylogeny on the elemental composition of plants both at early (with the development of key preadaptive traits) and recent divergence times (diversification of the Iberian gypsum flora concurrent with Iberian gypsum deposit accumulation). Despite the predominant phylogenetic effect, plant adaptation to gypsum soils had a strong impact on the elemental composition of plants, particularly on sulphur concentrations, while climate and soil effects were smaller.</p><p>Accordingly, we detected a convergent evolution of gypsum specialists from different lineages on increased sulphur and magnesium foliar concentrations.</p></p", "keywords": ["2. Zero hunger", "0106 biological sciences", "0301 basic medicine", "Research", "Variance partitioning", "Plants", "15. Life on land", "Multiple phylogenetic variance decomposition (MPVD)", "Calcium Sulfate", "01 natural sciences", "Stoichiometry", "Ionome", "Soil", "03 medical and health sciences", "Biogeochemical niche", "13. Climate action", "Ionome multiple phylogenetic variance decomposition (MPVD)", "Edaphic endemics", "Phylogenetic effects", "Gypsophile", "Ecosystem", "Phylogeny", "Sulfur"]}, "links": [{"href": "https://nph.onlinelibrary.wiley.com/doi/pdf/10.1111/nph.18309"}, {"href": "https://doi.org/10.1111/nph.18309"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/New%20Phytologist", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/nph.18309", "name": "item", "description": "10.1111/nph.18309", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/nph.18309"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-07-13T00:00:00Z"}}, {"id": "10.1111/nph.15119", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:19:49Z", "type": "Journal Article", "created": "2018-03-31", "title": "Biodiversity of arbuscular mycorrhizal fungi and ecosystem function", "description": "<p>         Contents      Summary 1059   I. Introduction: pathways of influence and pervasiveness of effects 1060   II. AM fungal richness effects on ecosystem functions 1062   III. Other dimensions of biodiversity 1062   IV. Back to basics \uffe2\uff80\uff93 primary axes of niche differentiation by AM fungi 1066   V. Functional diversity of AM fungi \uffe2\uff80\uff93 a role for biological stoichiometry? 1067   VI. Past, novel and future ecosystems 1068   VII. Opportunities and the way forward 1071    Acknowledgements 1072    References 1072      </p>Summary<p>Arbuscular mycorrhizal (AM) fungi play important functional roles in ecosystems, including the uptake and transfer of nutrients, modification of the physical soil environment and alteration of plant interactions with other biota. Several studies have demonstrated the potential for variation in AM fungal diversity to also affect ecosystem functioning, mainly via effects on primary productivity. Diversity in these studies is usually characterized in terms of the number of species, unique evolutionary lineages or complementary mycorrhizal traits, as well as the ability of plants to discriminate among AM fungi in space and time. However, the emergent outcomes of these relationships are usually indirect, and thus context dependent, and difficult to predict with certainty. Here, we advocate a fungal\uffe2\uff80\uff90centric view of AM fungal biodiversity\uffe2\uff80\uff93ecosystem function relationships that focuses on the direct and specific links between AM fungal fitness and consequences for their roles in ecosystems, especially highlighting functional diversity in hyphal resource economics. We conclude by arguing that an understanding of AM fungal functional diversity is fundamental to determine whether AM fungi have a role in the exploitation of marginal/novel environments (whether past, present or future) and highlight avenues for future research.</p>", "keywords": ["580", "0301 basic medicine", "2. Zero hunger", "0303 health sciences", "Biodiversity", "Plants", "15. Life on land", "stoichiometry", "03 medical and health sciences", "Mycorrhizae", "XXXXXX - Unknown", "ecosystems", "global change", "biodiversity"]}, "links": [{"href": "https://nph.onlinelibrary.wiley.com/doi/pdf/10.1111/nph.15119"}, {"href": "https://doi.org/10.1111/nph.15119"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/New%20Phytologist", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/nph.15119", "name": "item", "description": "10.1111/nph.15119", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/nph.15119"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-03-30T00:00:00Z"}}, {"id": "10.3389/fmicb.2022.859063", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:21:32Z", "type": "Journal Article", "created": "2022-05-17", "title": "Interacting Bioenergetic and Stoichiometric Controls on Microbial Growth", "description": "<p>Microorganisms function as open systems that exchange matter and energy with their surrounding environment. Even though mass (carbon and nutrients) and energy exchanges are tightly linked, there is a lack of integrated approaches that combine these fluxes and explore how they jointly impact microbial growth. Such links are essential to predicting how the growth rate of microorganisms varies, especially when the stoichiometry of carbon- (C) and nitrogen (N)-uptake is not balanced. Here, we present a theoretical framework to quantify the microbial growth rate for conditions of C-, N-, and energy-(co-) limitations. We use this framework to show how the C:N ratio and the degree of reduction of the organic matter (OM), which is also the electron donor, availability of electron acceptors (EAs), and the different sources of N together control the microbial growth rate under C, nutrient, and energy-limited conditions. We show that the growth rate peaks at intermediate values of the degree of reduction of OM under oxic and C-limited conditions, but not under N-limited conditions. Under oxic conditions and with N-poor OM, the growth rate is higher when the inorganic N (NInorg)-source is ammonium compared to nitrate due to the additional energetic cost involved in nitrate reduction. Under anoxic conditions, when nitrate is both EA and NInorg-source, the growth rates of denitrifiers and microbes performing the dissimilatory nitrate reduction to ammonia (DNRA) are determined by both OM degree of reduction and nitrate-availability. Consistent with the data, DNRA is predicted to foster growth under extreme nitrate-limitation and with a reduced OM, whereas denitrifiers are favored as nitrate becomes more available and in the presence of oxidized OM. Furthermore, the growth rate is reduced when catabolism is coupled to low energy yielding EAs (e.g., sulfate) because of the low carbon use efficiency (CUE). However, the low CUE also decreases the nutrient demand for growth, thereby reducing N-limitation. We conclude that bioenergetics provides a useful conceptual framework for explaining growth rates under different metabolisms and multiple resource-limitations.</p>", "keywords": ["0301 basic medicine", "0303 health sciences", "denitrification", "660", "nitrogen limitation", "microbial growth", "Biological Sciences", "bioenergetics", "Microbiology", "QR1-502", "stoichiometry", "DNRA", "thermodynamics", "03 medical and health sciences", "Geovetenskap och relaterad milj\u00f6vetenskap", "Microbiology (Microbiology in the medical area to be 30109)", "Biologiska vetenskaper", "Bioenergy", "Earth and Related Environmental Sciences", "energy limitation"]}, "links": [{"href": "https://pub.epsilon.slu.se/28342/1/chakrawal-a-et-al-220615.pdf"}, {"href": "https://doi.org/10.3389/fmicb.2022.859063"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/fmicb.2022.859063", "name": "item", "description": "10.3389/fmicb.2022.859063", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/fmicb.2022.859063"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-05-17T00:00:00Z"}}, {"id": "10.5281/zenodo.11406309", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:23:05Z", "type": "Dataset", "title": "GIRF Pulse Experiment", "description": "R code for Hastings, Y. D. (2022). Green Infrastructure Microbial Community Response to Simulated Pulse Precipitation Events in the Semi-Arid Western United States (Master's thesis, The University of Utah). This study was supported by a grant from the US National Science Foundation (DEB 2006308).  R code for and Hastings, Y. D., et al. Green Infrastructure Microbial Community Response to Simulated Pulse Precipitation Events in the Semi-Arid Western United States. In review.  Abstract: Nutrient retention in urban stormwater green infrastructure (SGI) of water-limited biomes is not well quantified, especially when stormwater inputs are scarce. We examined the role of plant diversity and physiochemistry as drivers of microbial community physiology and soil N pools and fluxes in bioswales subjected to simulated precipitation and a montane meadow experiencing natural rainfall within a semi-arid region during drought. Precipitation generally elevated soil moisture and pH, stimulated ecoenzyme activity, and increased the concentration of organic matter, proteins, and N pools in both bioswale and meadow soils; but the magnitude of change differed between events. Microbial community growth was static and N assimilation into biomass was limited across precipitation events. Unvegetated SGI plots had greater soil moisture, yet effects of plant diversity treatments on microbial C:N ratios, organic matter content, and N pools were inconsistent. Differences in soil N concentrations in bioswales and the meadow were most directly correlated to changes in organic matter content mediated by ecoenzyme expression and the balance of C, N, and P resources available to microbial communities. Our results add to growing evidence that ecological function of SGI is comparable to neighboring natural vegetated systems, particularly when soil media and water availability are similar.  The file and R code structure is as follows:    Data - Contains all data used for the analysis  Results - Contains all figures, RMANOVA, and Piecewise Structural Equation Modeling results.  renv - R environment used for project  EEA_Vector_Analysis.R - R code used to analyze coenzyme (EEA) responses, including RMANOVA to look for significant differences in EEA response to simulated pulse events and Vector Analysis to determine the nutrient resource acquisition.  Gravimetric_soil_moisture_pH.R - R code used for RMANOVA of gravimetric soil moisture and pH responses to simulated pulse events.  MicrobialBiomass_EEA.Rproj - Downloaded R project  Microbial_biomass.R - R code used for RMANOVA of microbial biomass carbon, nitrogen, and C:N responses to simulated pulse events.  OM_protien_N_pools_fluxes.R - R code used for RMANOVA of organic matter content, proteins, and N pools and fluxes responses to simulated pulse events.  PSEM_final.R - R code used for Pearson Correlation and Piecewise Structural Equation Modeling.  Rclimate.R - R code used to obtain summary statistics of climate data from GIRF and TM climate and soil sensors.", "keywords": ["green infrastructure", "microbial biomass", "ecoenzyme activity", "soils", "nitrogen", "plant diversity", "nature-based solutions", "stoichiometry"], "contacts": [{"organization": "Hastings, Yvette D", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5281/zenodo.11406309"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.11406309", "name": "item", "description": "10.5281/zenodo.11406309", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.11406309"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-06-04T00:00:00Z"}}, {"id": "10.3389/fevo.2021.714134", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:21:30Z", "type": "Journal Article", "created": "2021-09-30", "title": "Intracellular Storage Reduces Stoichiometric Imbalances in Soil Microbial Biomass \u2013 A Theoretical Exploration", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Microbial intracellular storage is key to defining microbial resource use strategies and could contribute to carbon (C) and nutrient cycling. However, little attention has been devoted to the role of intracellular storage in soil processes, in particular from a theoretical perspective. Here we fill this gap by integrating intracellular storage dynamics into a microbially explicit soil C and nutrient cycling model. Two ecologically relevant modes of storage are considered: reserve storage, in which elements are routed to a storage compartment in proportion to their uptake rate, and surplus storage, in which elements in excess of microbial stoichiometric requirements are stored and limiting elements are remobilized from storage to fuel growth and microbial maintenance. Our aim is to explore with this model how these different storage modes affect the retention of C and nutrients in active microbial biomass under idealized conditions mimicking a substrate pulse experiment. As a case study, we describe C and phosphorus (P) dynamics using literature data to estimate model parameters. Both storage modes enhance the retention of elements in microbial biomass, but the surplus storage mode is more effective to selectively store or remobilize C and nutrients according to microbial needs. Enhancement of microbial growth by both storage modes is largest when the substrate C:nutrient ratio is high (causing nutrient limitation after substrate addition) and the amount of added substrate is large. Moreover, storage increases biomass nutrient retention and growth more effectively when resources are supplied in a few large pulses compared to several smaller pulses (mimicking a nearly constant supply), which suggests storage to be particularly relevant in highly dynamic soil microhabitats. Overall, our results indicate that storage dynamics are most important under conditions of strong stoichiometric imbalance and may be of high ecological relevance in soil environments experiencing large variations in C and nutrient supply.</p></article>", "keywords": ["0301 basic medicine", "2. Zero hunger", "ecological stoichiometry", "nutrient limitation", "0303 health sciences", "microbial model", "Ecology", "Evolution", "15. Life on land", "surplus accumulation", "6. Clean water", "reserve storage", "03 medical and health sciences", "13. Climate action", "international", "QH359-425", "Plan_S-Compliant_OA", "QH540-549.5"]}, "links": [{"href": "https://doi.org/10.3389/fevo.2021.714134"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/fevo.2021.714134", "name": "item", "description": "10.3389/fevo.2021.714134", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/fevo.2021.714134"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-09-30T00:00:00Z"}}, {"id": "10.3389/ffgc.2020.543112", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:21:30Z", "type": "Journal Article", "created": "2020-10-15", "title": "Modeling Soil Responses to Nitrogen and Phosphorus Fertilization Along a Soil Phosphorus Stock Gradient", "description": "In this study, we investigate the responses of soil organic carbon (C) to nitrogen (N) and phosphorus (P) additions along a soil P stock gradient of five beech forest stands in Germany, using a modeling approach. Two different soil models with coupled C, N, and P cycles are used to simulate fertilization experiments conducted at the study sites. The first model, the stand-alone soil module of QUINCY (QUINCY-soil, Thum et al., 2019), is a conventional soil model that uses first-order kinetics to describe soil organic matter (SOM) turnover and represents microbial biomass only implicitly. The second model, the Jena Soil Model (JSM) (Yu et al., 2020), is a novel microbial soil model, which explicitly simulates microbial dynamics and describes the turnover of SOM as the consequence of several interactive processes, such as microbially mediated depolymerization of litter and SOM, organo-mineral association, and vertical transport. We applied both site-level models to five study sites and compared the modeled soil profile with observations. In addition, model scenarios were conducted to simulate the fertilization of N and P, and we further evaluate the effect of soil P stock, plant litter quality, and SOM CNP stoichiometry, on the responses of soil (heterotrophic) respiration (Rs) to nutrient addition. We found that the fitness between simulated and observed SOM profiles (defined as normalized root mean square ratios, Knrmsr) were generally better in JSM than in QUINCY-soil (Knrmsr larger by 0.03 \u00b1 0.10 to 0.16 \u00b1 0.06 for various soil measurements at all sites); The general pattern of observed Rs responses to nutrient fertilization, that N addition decreases Rs whereas P addition increases it, can be reproduced by JSM but not by QUINCY-soil. Our results indicated that a detailed explicit description of microbial processes and organo-mineral association is required to model plant-soil-microbial interactions, thus to better reproduce SOM profiles and their responses to nutrient additions. It highlights the need to better represent these processes in future model developments.", "keywords": ["2. Zero hunger", "Forestry", "04 agricultural and veterinary sciences", "SD1-669.5", "15. Life on land", "01 natural sciences", "nitrogen", "stoichiometry", "soil models", "microbe", "Environmental sciences", "0401 agriculture", " forestry", " and fisheries", "GE1-350", "phosphorus", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.3389/ffgc.2020.543112"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Forests%20and%20Global%20Change", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/ffgc.2020.543112", "name": "item", "description": "10.3389/ffgc.2020.543112", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/ffgc.2020.543112"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-10-15T00:00:00Z"}}, {"id": "10.3389/ffgc.2021.686945", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:21:30Z", "type": "Journal Article", "created": "2021-06-11", "title": "Modeling Microbial Adaptations to Nutrient Limitation During Litter Decomposition", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Microbial decomposers face large stoichiometric imbalances when feeding on nutrient-poor plant residues. To meet the challenges of nutrient limitation, microorganisms might: (i) allocate less carbon (C) to growth vs. respiration or excretion (i.e., flexible C-use efficiency, CUE), (ii) produce extracellular enzymes to target compounds that supply the most limiting element, (iii) modify their cellular composition according to the external nutrient availability, and (iv) preferentially retain nutrients at senescence. These four resource use modes can have different consequences on the litter C and nitrogen (N) dynamics\u2013modes that selectively remove C from the system can reduce C storage in soil, whereas modes that delay C mineralization and increase internal N recycling could promote storage of C and N. Since we do not know which modes are dominant in litter decomposers, we cannot predict the fate of C and N released from plant residues, in particular under conditions of microbial nutrient limitation. To address this question, we developed a process-based model of litter decomposition in which these four resource use modes were implemented. We then parameterized the model using \u223c80 litter decomposition datasets spanning a broad range of litter qualities. The calibrated model variants were able to capture most of the variability in litter C, N, and lignin fractions during decomposition regardless of which modes were included. This suggests that different modes can lead to similar litter decomposition trajectories (thanks to the multiple alternative resource acquisition pathways), and that identification of dominant modes is not possible using \u201cstandard\u201d litter decomposition data (an equifinality problem). Our results thus point to the need of exploring microbial adaptations to nutrient limitation with empirical estimates of microbial traits and to develop models flexible enough to consider a range of hypothesized microbial responses.</p></article>", "keywords": ["2. Zero hunger", "microbial model", "carbon use efficiency", "nitrogen limitation", "Forestry", "extracellular enzymes", "litter decomposition", "04 agricultural and veterinary sciences", "Biological Sciences", "SD1-669.5", "15. Life on land", "microbial stoichiometry", "C/N ratio", "C:N ratio", "12. Responsible consumption", "Environmental sciences", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Biologiska vetenskaper", "GE1-350"]}, "links": [{"href": "https://doi.org/10.3389/ffgc.2021.686945"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Forests%20and%20Global%20Change", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/ffgc.2021.686945", "name": "item", "description": "10.3389/ffgc.2021.686945", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/ffgc.2021.686945"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-11T00:00:00Z"}}, {"id": "10.5061/dryad.c2fqz61cf", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:22:15Z", "type": "Dataset", "title": "Oxygen availability regulates the quality of soil dissolved organic matter by mediating microbial metabolism and iron oxidation", "description": "Dissolved organic matter (DOM) plays a vital role in biogeochemical  processes and in determining the responses of soil organic matter (SOM) to  global change. Although the quantity of soil DOM has been inventoried  across diverse spatio-temporal scales, the underlying mechanisms  accounting for variability in DOM dynamics remain unclear, especially in  upland ecosystems. Here, a gradient of SOM storage across twelve croplands  in northeast China was used to understand links between DOM dynamics,  microbial metabolism, and abiotic conditions. We assessed the composition,  biodegradability and key biodegradable components of DOM. In addition, SOM  and mineral-associated organic matter (MAOM) composition, soil enzyme  activities, oxygen availability, soil texture, iron (Fe), Fe-bound organic  matter and nutrient concentrations were quantified to clarify the drivers  of DOM quality (composition and biodegradability). The proportion of  biodegradable DOM increased exponentially with decreasing initial DOM  concentration due to larger fractions of depolymerized DOM that was rich  in small-molecular phenols and proteinaceous components. Unexpectedly, the  composition of DOM was decoupled from that of SOM or MAOM, but  significantly related to enzymatic properties. These results indicate that  microbial metabolism exhibited a dominant role in DOM generation. As DOM  concentration declined, increased soil oxygen availability regulated DOM  composition and enhanced its biodegradability mainly through mediating  microbial metabolism and Fe oxidation. The oxygen-induced oxidation of  Fe(II) to Fe(III) removed complex DOM compounds with large molecular  weight. Moreover, increased oxygen availability stimulated  oxidase-catalyzed depolymerization of aromatic substances, and promoted  production of protein-like DOM components due to lower enzymatic C/N  acquisition ratio. As global changes in temperature and moisture will have  large impacts on soil oxygen availability, the role of oxygen in  regulating DOM dynamics highlights the importance of integrating soil  oxygen supply with microbial metabolism and Fe redox status to improve  model predictions of soil carbon under climate change.", "keywords": ["2. Zero hunger", "soil organic carbon", "iron cycling", "13. Climate action", "FOS: Agricultural sciences", "Biodegradation", "oxygen availability", "enzymatic stoichiometry", "15. Life on land", "dissolved organic matter", "6. Clean water"], "contacts": [{"organization": "Li, Ye, Chen, Zengming, Chen, Ji, Castellano, Michael J., Ye, Chenglong, Zhang, Nan, Miao, Yuncai, Zheng, Huijie, Li, Junjie, Ding, Weixin,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.c2fqz61cf"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.c2fqz61cf", "name": "item", "description": "10.5061/dryad.c2fqz61cf", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.c2fqz61cf"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-10-23T00:00:00Z"}}, {"id": "10.5061/dryad.22jr6", "type": "Feature", "geometry": null, "properties": {"license": "unspecified", "updated": "2026-06-23T16:22:11Z", "type": "Dataset", "title": "Data from: Thermodynamic constraints on the utility of ecological stoichiometry for explaining global biogeochemical patterns", "description": "unspecifiedCarbon and nitrogen cycles are coupled through both stoichiometric  requirements for microbial biomass and dissimilatory metabolic processes  in which microbes catalyse reduction-oxidation reactions. Here, we  integrate stoichiometric theory and thermodynamic principles to explain  the commonly observed trade-off between high nitrate and high organic  carbon concentrations, and the even stronger trade-off between high  nitrate and high ammonium concentrations, across a wide range of aquatic  ecosystems. Our results suggest these relationships are the emergent  properties of both microbial biomass stoichiometry and the availability of  terminal electron acceptors. Because elements with multiple oxidation  states (i.e. nitrogen, manganese, iron and sulphur) serve as both  nutrients and sources of chemical energy in reduced environments, both  assimilative demand and dissimilatory uses determine their concentrations  across broad spatial gradients. Conceptual and quantitative models that  integrate rather than independently examine thermodynamic, stoichiometric  and evolutionary controls on biogeochemical cycling are essential for  understanding local to global biogeochemical patterns.", "keywords": ["13. Climate action", "nitrate", "dissimilatory microbial metabolism", "15. Life on land", "reduction-oxidation reactions", "organismal stoichiometry", "6. Clean water", "Carbon"], "contacts": [{"organization": "Helton, Ashley M., Ardon, Marcelo, Bernhardt, Emily S.,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.22jr6"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.22jr6", "name": "item", "description": "10.5061/dryad.22jr6", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.22jr6"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2015-09-18T00:00:00Z"}}, {"id": "10.5061/dryad.gv2qr76", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:22:17Z", "type": "Dataset", "title": "Data from: Positive plant-soil feedbacks trigger tannin evolution by niche construction: a spatial stoichiometric model", "description": "unspecifiedspatial  implicitPython 2 code to  reproduce Fig. 3. The prediction for tannin evolution in the spatial  implicit approach, as a function of turnover rate and soil  fertility.cellular_automatonPython 2 code of the cellular automaton, used to generate Fig. 2 and Fig. 4.coevolutionPython 2 code to smile;ulate the coevolutionary dynamics of symbiotic capacity and tannin production.", "keywords": ["2. Zero hunger", "spatial dynamics", "plant\u2013herbivore interactions", "Niche construction", "15. Life on land", "Plant secondary metabolites", "mycorrhizae", "Stoichiometry"], "contacts": [{"organization": "Arnoldi, Jean-Fran\u00e7ois, Coq, Sylvain, K\u00e9fi, Sonia, Ibanez, Sebastien,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.gv2qr76"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.gv2qr76", "name": "item", "description": "10.5061/dryad.gv2qr76", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.gv2qr76"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-06-19T00:00:00Z"}}, {"id": "10.5061/dryad.h3m2jf7", "type": "Feature", "geometry": null, "properties": {"license": "unspecified", "updated": "2026-06-23T16:22:17Z", "type": "Dataset", "title": "Data from: Soil microbial processes and resource limitation in karst and non-karst forests", "description": "unspecified1. Soil microorganisms play a key role in soil biogeochemical cycles, but  their growth and activities are often limited by resource availability.  Understanding soil processes that are driven by microorganisms and  resource limitation of microbes will help to elucidate controls on soil  fertility and improve the ability to predict the responses of an ecosystem  to global changes. As a widespread ecosystem type, karst ecosystem  develops from limestone or dolomite with unique soil, however, karst  ecosystems remains poorly understood regarding their soil microbial  processes and microbial resource limitation. 2. Here, ecoenzymatic  stoichiometry was used as an indicator of microbial resource limitation,  and to model major microbial processes (i.e., decomposition of soil  organic carbon and microbial respiration) in a karst and a non-karst  forest. 3. Results showed that the modeled decomposition and respiration  rates were significantly higher in the karst forest than in the non-karst  forest. In addition, results of ecoenzymatic stoichiometry showed that the  karst forest was more carbon-limited than the non-karst forest. In  contrast, the karst forest was likely saturated with nitrogen, but the  non-karst forest was limited by nitrogen. Both the karst and non-karst  forests were limited by phosphorus, but phosphorus deficiency was more  evident in the non-karst forest than in the karst forest. 4. These  findings highlight the specific profiles of karst ecosystems, and they  suggest that the responses of karst ecosystems to global changes should be  very different compared to other ecosystems.", "keywords": ["nutrient limitation", "C limitation", "ecoenzymatic stoichiometry", "calcareous soil", "13. Climate action", "karst forest", "15. Life on land", "enzyme activity"], "contacts": [{"organization": "Chen, Hao, Li, Dejun, Xiao, Kongcao, Wang, Kelin,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.h3m2jf7"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.h3m2jf7", "name": "item", "description": "10.5061/dryad.h3m2jf7", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.h3m2jf7"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-02-08T00:00:00Z"}}, {"id": "10.5281/zenodo.15687463", "type": "Feature", "geometry": null, "properties": {"license": "unspecified", "updated": "2026-06-23T16:24:01Z", "type": "Dataset", "title": "Nitrogen and phosphorus distribution in global agricultural soils", "description": "Total organic carbon, total nitrogen, total phosphorus, and available N and P in global agricultural soils", "keywords": ["Elemental stoichiometry", "Soil organic carbon", "Soil fertility"], "contacts": [{"organization": "Luo, Lei", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5281/zenodo.15687463"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.15687463", "name": "item", "description": "10.5281/zenodo.15687463", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.15687463"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2025-06-18T00:00:00Z"}}, {"id": "10.5281/zenodo.16310622", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:24:05Z", "type": "Dataset", "title": "Dataset for substrate stoichiometry drive the divergent accumulation of plant and microbial necromass carbon", "description": "To optimize the conversion of exogenous C into soil organic C, we manipulated the substrate stoichiometry (SS) match the requirements ranging from oligotrophs to copiotrophs. We assumed the stoichiometric ratios of fungi (C:N:P:S=10,000:1034:110:94) and bacteria (C:N:P:S=10,000:2004:494: 264) reflected substrate requirements of oligotrophs and copiotrophs. This study provided different SS levels by applying varying amounts of straw and N, P, and S. A total of five treatment groups were established: straw\u2011amended soil with no nutrient addition (NPS0), NPS0 with nutrient additions to meet the metabolic requirements from fungi (NPS1) to bacteria (NPS3), and a control soil (CK). The straw, cut into 2\u20135 mm pieces, was mixed with soil at a rate of 2 g per 100 g dry soil. The SS was regulated by adding or not adding the nutrient solutions (NS1, NS2 or NS3) containing ammonium nitrate, potassium dihydrogen phosphate, and ammonium sulfate (pH = 7). The concentrations of N, P, and S in NS1 were 6.42, 1.79, and 0.95 g L\u22121, in NS2 were 19.50, 3.52, and 1.90 g L\u22121, and in NS3 were 30.72, 9.98, and 4.23 g L\u22121, respectively.  Topsoil (0\u201320 cm) and subsoil (20\u201340 cm) samples (8 kg each) were collected, sieved at 2 mm, and air-dry. The SS was regulated by adding 1 ml of NS1, NS2, or NS3 to 100 g of dry topsoil on a clean and smooth plastic sheet. The soil moisture was then adjusted to 60% field capacity with distilled water, followed by the addition and mixing of 2 g straw fragments. The mixture was then transferred to nylon mesh bags and sealed (aperture: 0.048 mm, length: 20 cm, and width: 15 cm). The subsoil was treated in the same manner. Nine replicates were maintained for each treatment for both topsoil or subsoil. Three soil pits (length: 1.5 m, width: 0.5 m, depth: 0.4 m) spaced at 0.6 m apart were dug in the field, and the topsoil and subsoil were stored separately. Three replicates of each treatment for subsoil were arranged in two rows (spaced approximately 20 cm) and vertically placed at 20\u201340 cm in each pit. Each pit was backfilled with the original subsoil. The same procedure was followed to fill the pits with the replicates of the five treatments for topsoil. All replicates from one pit were collected at 30, 90, and 150 days post-sowing, then brought back to the laboratory with dry ice and stored at \u201380\u2103.  This study primarily investigated the following parameters: including (1) amino sugars, lignin phenols, soil water content, soil organic C (SOC), available N (AN), and available P (SAP); (2) C, N, and P cycling enzyme activities (cellobiohydrolase (CBH), \u03b2-glucosidase (BG), L-leucine aminopeptidase (LAP), \u00a0\u03b2-N-acetylglucosaminidase (NAG), and acid phosphatase (AP)); and (3) bacterial and fungal diversity and community composition at the phylum level. The main statistical analyses employed included one-way ANOVA, principal coordinates analysis (PCoA), and random forest models.", "keywords": ["agricultural residues", " microbial stoichiometry metabolism", " microbial necromass carbon"], "contacts": [{"organization": "Wu", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5281/zenodo.16310622"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.16310622", "name": "item", "description": "10.5281/zenodo.16310622", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.16310622"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2025-07-22T00:00:00Z"}}, {"id": "10037/14672", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:25:32Z", "type": "Journal Article", "created": "2018-10-05", "title": "Ecological stoichiometry and nutrient partitioning in two insect herbivores responsible for large\u2010scale forest disturbance in the Fennoscandian subarctic", "description": "<p>1. Outbreaks of herbivorous insects can have large impacts on regional soil carbon (C) storage and nutrient cycling. In northernmost Europe, population outbreaks of several geometrid moth species regularly cause large\uffe2\uff80\uff90scale defoliation in subarctic birch forests. An improved understanding is required of how leaf C and nutrients are processed after ingestion by herbivores and what this means for the quantity and quality of different materials produced (frass, bodies).</p>                   <p>                     2. In this study, larvae of two geometrid species responsible for major outbreaks (                     Epirrita autumnata                     and                                            Operophtera brumata                                          ) were raised on exclusive diets of                                            Betula pubescens                                          var.                     czerepanovii                     (N. I. Orlova) H\uffc3\uffa4met Ahti and two other abundant understorey species (                                            Betula nana                                          ,                                            Vaccinium myrtillus                                          ). The quantities of C, nitrogen (N) and phosphorus (P) ingested and allocated to frass, bodies and (in the case of C) respired were recorded.                   </p>                   <p>                     3. Overall, 23%, 70% and 48% of ingested C, N and P were allocated to bodies, respectively, rather than frass and (in the case of C) respiration.                                            Operophtera brumata                                          consistently maintained more constant body stoichiometric ratios of C, N and P than did                     E. autumnata                     , across the wide variation in physico\uffe2\uff80\uff90chemical properties of plant diet supplied.                   </p>                   <p>4. These observed differences and similarities on C and nutrient processing may improve researchers' ability to predict the amount and stoichiometry of frass and bodies generated after geometrid outbreaks.</p", "keywords": ["2. Zero hunger", "VDP::Mathematics and natural science: 400::Zoology and botany: 480::Ecology: 488", "0106 biological sciences", "570", "ecological stoichiometry", "590", "subarctic birch forest", "15. Life on land", "geometrid moth", "01 natural sciences", "[SDE.BE] Environmental Sciences/Biodiversity and Ecology", "VDP::Matematikk og Naturvitenskap: 400::Zoologiske og botaniske fag: 480::\u00d8kologi: 488", "Consumer\u2010driven nutrient recycling", "13. Climate action", "[SDV.EE.ECO]Life Sciences [q-bio]/Ecology", "homeostasis", "[SDV.EE.ECO] Life Sciences [q-bio]/Ecology", " environment/Ecosystems", "stable isotope", "[SDE.BE]Environmental Sciences/Biodiversity and Ecology", "environment/Ecosystems"]}, "links": [{"href": "http://onlinelibrary.wiley.com/wol1/doi/10.1111/een.12679/fullpdf"}, {"href": "https://doi.org/10037/14672"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecological%20Entomology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10037/14672", "name": "item", "description": "10037/14672", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10037/14672"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-10-04T00:00:00Z"}}, {"id": "10045/108728", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:25:33Z", "type": "Journal Article", "created": "2020-06-12", "title": "Long\u2010term nitrogen loading alleviates phosphorus limitation in terrestrial ecosystems", "description": "Abstract<p>Increased human\uffe2\uff80\uff90derived nitrogen (N) deposition to terrestrial ecosystems has resulted in widespread phosphorus (P) limitation of net primary productivity. However, it remains unclear if and how N\uffe2\uff80\uff90induced P limitation varies over time. Soil extracellular phosphatases catalyze the hydrolysis of P from soil organic matter, an important adaptive mechanism for ecosystems to cope with N\uffe2\uff80\uff90induced P limitation. Here we show, using a meta\uffe2\uff80\uff90analysis of 140 studies and 668 observations worldwide, that N stimulation of soil phosphatase activity diminishes over time. Whereas short\uffe2\uff80\uff90term N loading (\uffe2\uff89\uffa45\uffc2\uffa0years) significantly increased soil phosphatase activity by 28%, long\uffe2\uff80\uff90term N loading had no significant effect. Nitrogen loading did not affect soil available P and total P content in either short\uffe2\uff80\uff90 or long\uffe2\uff80\uff90term studies. Together, these results suggest that N\uffe2\uff80\uff90induced P limitation in ecosystems is alleviated in the long\uffe2\uff80\uff90term through the initial stimulation of soil phosphatase activity, thereby securing P supply to support plant growth. Our results suggest that increases in terrestrial carbon uptake due to ongoing anthropogenic N loading may be greater than previously thought.</p", "keywords": ["Nitrogen", "Microbial biomass", "phosphorus limitation", "Phosphorus limitation", "Soil pH", "nitrogen addition", "Soil phosphorus content", "soil pH", "Soil phosphatase activity", "Soil", "Soil nitrogen content", "soil nitrogen content", "Humans", "Biomass", "Ecosystem", "2. Zero hunger", "Nitrogen addition", "microbial biomass", "nutrient stoichiometry balance", "Phosphorus", "04 agricultural and veterinary sciences", "Ecolog\u00eda", "15. Life on land", "Carbon", "soil phosphatase activity", "soil phosphorus content", "Nutrient stoichiometry balance", "13. Climate action", "0401 agriculture", " forestry", " and fisheries"]}, "links": [{"href": "https://onlinelibrary.wiley.com/doi/pdf/10.1111/gcb.15218"}, {"href": "https://doi.org/10045/108728"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Global%20Change%20Biology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10045/108728", "name": "item", "description": "10045/108728", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10045/108728"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-07-01T00:00:00Z"}}, {"id": "10261/359494", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:25:42Z", "type": "Journal Article", "created": "2022-06-15", "title": "Recent and ancient evolutionary events shaped plant elemental composition of edaphic endemics: a phylogeny\u2010wide analysis of Iberian gypsum plants", "description": "Summary<p><p>The analysis of plant elemental composition and the underlying factors affecting its variation are a current hot topic in ecology. Ecological adaptation to atypical soils may shift plant elemental composition. However, no previous studies have evaluated its relevance against other factors such as phylogeny, climate or individual soil conditions.</p><p>We evaluated the effect of the phylogeny, environment (climate, soil), and affinity to gypsum soils on the elemental composition of 83 taxa typical of Iberian gypsum ecosystems. We used a new statistical procedure (multiple phylogenetic variance decomposition, MPVD) to decompose total explained variance by different factors across all nodes in the phylogenetic tree of target species (covering 120\uffe2\uff80\uff89million\uffe2\uff80\uff89years of Angiosperm evolution).</p><p>Our results highlight the relevance of phylogeny on the elemental composition of plants both at early (with the development of key preadaptive traits) and recent divergence times (diversification of the Iberian gypsum flora concurrent with Iberian gypsum deposit accumulation). Despite the predominant phylogenetic effect, plant adaptation to gypsum soils had a strong impact on the elemental composition of plants, particularly on sulphur concentrations, while climate and soil effects were smaller.</p><p>Accordingly, we detected a convergent evolution of gypsum specialists from different lineages on increased sulphur and magnesium foliar concentrations.</p></p", "keywords": ["0106 biological sciences", "0301 basic medicine", "2. Zero hunger", "Research", "Variance partitioning", "Plants", "15. Life on land", "Multiple phylogenetic variance decomposition (MPVD)", "Calcium Sulfate", "01 natural sciences", "Stoichiometry", "Ionome", "Soil", "03 medical and health sciences", "Biogeochemical niche", "13. Climate action", "Ionome multiple phylogenetic variance decomposition (MPVD)", "Edaphic endemics", "Phylogenetic effects", "Gypsophile", "Ecosystem", "Phylogeny", "Sulfur"]}, "links": [{"href": "https://nph.onlinelibrary.wiley.com/doi/pdf/10.1111/nph.18309"}, {"href": "https://doi.org/10261/359494"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/New%20Phytologist", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10261/359494", "name": "item", "description": "10261/359494", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10261/359494"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-07-13T00:00:00Z"}}, {"id": "10481/76429", "type": "Feature", "geometry": null, "properties": {"updated": "2026-06-23T16:25:49Z", "type": "Journal Article", "created": "2022-06-15", "title": "Recent and ancient evolutionary events shaped plant elemental composition of edaphic endemics: a phylogeny\u2010wide analysis of Iberian gypsum plants", "description": "Summary<p><p>The analysis of plant elemental composition and the underlying factors affecting its variation are a current hot topic in ecology. Ecological adaptation to atypical soils may shift plant elemental composition. However, no previous studies have evaluated its relevance against other factors such as phylogeny, climate or individual soil conditions.</p><p>We evaluated the effect of the phylogeny, environment (climate, soil), and affinity to gypsum soils on the elemental composition of 83 taxa typical of Iberian gypsum ecosystems. We used a new statistical procedure (multiple phylogenetic variance decomposition, MPVD) to decompose total explained variance by different factors across all nodes in the phylogenetic tree of target species (covering 120\uffe2\uff80\uff89million\uffe2\uff80\uff89years of Angiosperm evolution).</p><p>Our results highlight the relevance of phylogeny on the elemental composition of plants both at early (with the development of key preadaptive traits) and recent divergence times (diversification of the Iberian gypsum flora concurrent with Iberian gypsum deposit accumulation). Despite the predominant phylogenetic effect, plant adaptation to gypsum soils had a strong impact on the elemental composition of plants, particularly on sulphur concentrations, while climate and soil effects were smaller.</p><p>Accordingly, we detected a convergent evolution of gypsum specialists from different lineages on increased sulphur and magnesium foliar concentrations.</p></p", "keywords": ["0106 biological sciences", "0301 basic medicine", "2. Zero hunger", "Research", "Variance partitioning", "Plants", "15. Life on land", "Multiple phylogenetic variance decomposition (MPVD)", "Calcium Sulfate", "01 natural sciences", "Stoichiometry", "Ionome", "Soil", "03 medical and health sciences", "Biogeochemical niche", "13. Climate action", "Ionome multiple phylogenetic variance decomposition (MPVD)", "Edaphic endemics", "Phylogenetic effects", "Gypsophile", "Ecosystem", "Phylogeny", "Sulfur"]}, "links": [{"href": "https://nph.onlinelibrary.wiley.com/doi/pdf/10.1111/nph.18309"}, {"href": "https://doi.org/10481/76429"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/New%20Phytologist", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10481/76429", "name": "item", "description": "10481/76429", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10481/76429"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-07-13T00:00:00Z"}}, {"id": "2309129852", "type": "Feature", "geometry": null, "properties": {"license": "Closed Access", "updated": "2026-06-23T16:26:46Z", "type": "Journal Article", "created": "2016-03-26", "title": "Soil microbial carbon use efficiency and biomass turnover in a long-term fertilization experiment in a temperate grassland", "description": "<p>Soil microbial carbon use efficiency (CUE), defined as the ratio of organic C allocated to growth over organic C taken up, strongly affects soil carbon (C) cycling. Despite the importance of the microbial CUE for the terrestrial C cycle, very little is known about how it is affected by nutrient availability. Therefore, we studied microbial CUE and microbial biomass turnover time in soils of a long-term fertilization experiment in a temperate grassland comprising five treatments (control, PK, NK, NP, NPK). Microbial CUE and the turnover of microbial biomass were determined using a novel substrate-independent method based on incorporation of <sup>18</sup>O from labeled water into microbial DNA. Microbial respiration was 28-37% smaller in all three N treatments (NK, NP, and NPK) compared to the control, whereas the PK treatment did not affect microbial respiration. N-fertilization decreased microbial C uptake, while the microbial growth rate was not affected. Microbial CUE ranged between 0.31 and 0.45, and was 1.3- to 1.4-fold higher in the N-fertilized soils than in the control. The turnover time ranged between 80 and 113 days and was not significantly affected by fertilization. Net primary production (NPP) and the abundance of legumes differed strongly across the treatments, and the fungal:bacterial ratio was very low in all treatments. Structural equation modeling revealed that microbial CUE was exclusively controlled by N fertilization and that neither the abundance of legumes (as a proxy for the quality of the organic matter inputs) nor NPP (as a proxy for C inputs) had an effect on microbial CUE. Our results show that N fertilization did not only decrease microbial respiration, but also microbial C uptake, indicating that less C was intracellularly processed in the N fertilized soils. The reason for reduced C uptake and increased CUE in the N-fertilization treatments is likely an inhibition of oxidative enzymes involved in the degradation of aromatic compounds by N in combination with a reduced energy requirement for microbial N acquisition in the fertilized soils. In conclusion, the study shows that N availability can control soil C cycling by affecting microbial CUE, while plant community-mediated changes in organic matter inputs and P and K availability played no important role for C partitioning of the microbial community in this temperate grassland. </p>", "keywords": ["FUNGAL", "2. Zero hunger", "106022 Mikrobiologie", "Nitrogen addition", "BACTERIAL", "NITROGEN DEPOSITION", "GROWTH EFFICIENCY", "FOREST FLOOR", "Nutrients", "04 agricultural and veterinary sciences", "15. Life on land", "Stoichiometry", "ORGANIC-MATTER", "RESPIRATION", "106026 \u00d6kosystemforschung", "13. Climate action", "Nutrient limitation", "Microbial growth yield", "106022 Microbiology", "0401 agriculture", " forestry", " and fisheries", "Mean residence time", "STOICHIOMETRIC CONTROLS", "ENZYME-ACTIVITY", "106026 Ecosystem research", "COMMUNITY STRUCTURE"]}, "links": [{"href": "https://doi.org/2309129852"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "2309129852", "name": "item", "description": "2309129852", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/2309129852"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2016-06-01T00:00:00Z"}}, {"id": "20.500.11755/6f892ba7-93fa-4ced-ac75-2b5ff43692d6", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:26:25Z", "type": "Journal Article", "created": "2021-09-30", "title": "Intracellular Storage Reduces Stoichiometric Imbalances in Soil Microbial Biomass \u2013 A Theoretical Exploration", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Microbial intracellular storage is key to defining microbial resource use strategies and could contribute to carbon (C) and nutrient cycling. However, little attention has been devoted to the role of intracellular storage in soil processes, in particular from a theoretical perspective. Here we fill this gap by integrating intracellular storage dynamics into a microbially explicit soil C and nutrient cycling model. Two ecologically relevant modes of storage are considered: reserve storage, in which elements are routed to a storage compartment in proportion to their uptake rate, and surplus storage, in which elements in excess of microbial stoichiometric requirements are stored and limiting elements are remobilized from storage to fuel growth and microbial maintenance. Our aim is to explore with this model how these different storage modes affect the retention of C and nutrients in active microbial biomass under idealized conditions mimicking a substrate pulse experiment. As a case study, we describe C and phosphorus (P) dynamics using literature data to estimate model parameters. Both storage modes enhance the retention of elements in microbial biomass, but the surplus storage mode is more effective to selectively store or remobilize C and nutrients according to microbial needs. Enhancement of microbial growth by both storage modes is largest when the substrate C:nutrient ratio is high (causing nutrient limitation after substrate addition) and the amount of added substrate is large. Moreover, storage increases biomass nutrient retention and growth more effectively when resources are supplied in a few large pulses compared to several smaller pulses (mimicking a nearly constant supply), which suggests storage to be particularly relevant in highly dynamic soil microhabitats. Overall, our results indicate that storage dynamics are most important under conditions of strong stoichiometric imbalance and may be of high ecological relevance in soil environments experiencing large variations in C and nutrient supply.</p></article>", "keywords": ["2. Zero hunger", "0301 basic medicine", "ecological stoichiometry", "nutrient limitation", "0303 health sciences", "microbial model", "Ecology", "Evolution", "15. Life on land", "surplus accumulation", "6. Clean water", "reserve storage", "03 medical and health sciences", "13. Climate action", "international", "QH359-425", "Plan_S-Compliant_OA", "QH540-549.5"]}, "links": [{"href": "https://doi.org/20.500.11755/6f892ba7-93fa-4ced-ac75-2b5ff43692d6"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "20.500.11755/6f892ba7-93fa-4ced-ac75-2b5ff43692d6", "name": "item", "description": "20.500.11755/6f892ba7-93fa-4ced-ac75-2b5ff43692d6", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/20.500.11755/6f892ba7-93fa-4ced-ac75-2b5ff43692d6"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-09-30T00:00:00Z"}}, {"id": "3035344295", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:27:12Z", "type": "Journal Article", "created": "2020-06-12", "title": "Long\u2010term nitrogen loading alleviates phosphorus limitation in terrestrial ecosystems", "description": "Abstract<p>Increased human\uffe2\uff80\uff90derived nitrogen (N) deposition to terrestrial ecosystems has resulted in widespread phosphorus (P) limitation of net primary productivity. However, it remains unclear if and how N\uffe2\uff80\uff90induced P limitation varies over time. Soil extracellular phosphatases catalyze the hydrolysis of P from soil organic matter, an important adaptive mechanism for ecosystems to cope with N\uffe2\uff80\uff90induced P limitation. Here we show, using a meta\uffe2\uff80\uff90analysis of 140 studies and 668 observations worldwide, that N stimulation of soil phosphatase activity diminishes over time. Whereas short\uffe2\uff80\uff90term N loading (\uffe2\uff89\uffa45\uffc2\uffa0years) significantly increased soil phosphatase activity by 28%, long\uffe2\uff80\uff90term N loading had no significant effect. Nitrogen loading did not affect soil available P and total P content in either short\uffe2\uff80\uff90 or long\uffe2\uff80\uff90term studies. Together, these results suggest that N\uffe2\uff80\uff90induced P limitation in ecosystems is alleviated in the long\uffe2\uff80\uff90term through the initial stimulation of soil phosphatase activity, thereby securing P supply to support plant growth. Our results suggest that increases in terrestrial carbon uptake due to ongoing anthropogenic N loading may be greater than previously thought.</p", "keywords": ["Nitrogen", "Microbial biomass", "phosphorus limitation", "Phosphorus limitation", "Soil pH", "nitrogen addition", "Soil phosphorus content", "soil pH", "Soil phosphatase activity", "Soil", "Soil nitrogen content", "soil nitrogen content", "Humans", "Biomass", "Ecosystem", "2. Zero hunger", "Nitrogen addition", "microbial biomass", "nutrient stoichiometry balance", "Phosphorus", "04 agricultural and veterinary sciences", "Ecolog\u00eda", "15. Life on land", "Carbon", "soil phosphatase activity", "soil phosphorus content", "Nutrient stoichiometry balance", "13. Climate action", "0401 agriculture", " forestry", " and fisheries"]}, "links": [{"href": "https://onlinelibrary.wiley.com/doi/pdf/10.1111/gcb.15218"}, {"href": "https://doi.org/3035344295"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Global%20Change%20Biology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3035344295", "name": "item", "description": "3035344295", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3035344295"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2020-07-01T00:00:00Z"}}, {"id": "3167308845", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:27:21Z", "type": "Journal Article", "created": "2021-06-11", "title": "Modeling Microbial Adaptations to Nutrient Limitation During Litter Decomposition", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Microbial decomposers face large stoichiometric imbalances when feeding on nutrient-poor plant residues. To meet the challenges of nutrient limitation, microorganisms might: (i) allocate less carbon (C) to growth vs. respiration or excretion (i.e., flexible C-use efficiency, CUE), (ii) produce extracellular enzymes to target compounds that supply the most limiting element, (iii) modify their cellular composition according to the external nutrient availability, and (iv) preferentially retain nutrients at senescence. These four resource use modes can have different consequences on the litter C and nitrogen (N) dynamics\u2013modes that selectively remove C from the system can reduce C storage in soil, whereas modes that delay C mineralization and increase internal N recycling could promote storage of C and N. Since we do not know which modes are dominant in litter decomposers, we cannot predict the fate of C and N released from plant residues, in particular under conditions of microbial nutrient limitation. To address this question, we developed a process-based model of litter decomposition in which these four resource use modes were implemented. We then parameterized the model using \u223c80 litter decomposition datasets spanning a broad range of litter qualities. The calibrated model variants were able to capture most of the variability in litter C, N, and lignin fractions during decomposition regardless of which modes were included. This suggests that different modes can lead to similar litter decomposition trajectories (thanks to the multiple alternative resource acquisition pathways), and that identification of dominant modes is not possible using \u201cstandard\u201d litter decomposition data (an equifinality problem). Our results thus point to the need of exploring microbial adaptations to nutrient limitation with empirical estimates of microbial traits and to develop models flexible enough to consider a range of hypothesized microbial responses.</p></article>", "keywords": ["2. Zero hunger", "microbial model", "carbon use efficiency", "nitrogen limitation", "Forestry", "extracellular enzymes", "litter decomposition", "04 agricultural and veterinary sciences", "Biological Sciences", "SD1-669.5", "15. Life on land", "microbial stoichiometry", "C/N ratio", "C:N ratio", "12. Responsible consumption", "Environmental sciences", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Biologiska vetenskaper", "GE1-350"]}, "links": [{"href": "https://doi.org/3167308845"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Forests%20and%20Global%20Change", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3167308845", "name": "item", "description": "3167308845", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3167308845"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-11T00:00:00Z"}}, {"id": "3202337364", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:27:25Z", "type": "Journal Article", "created": "2021-09-30", "title": "Intracellular Storage Reduces Stoichiometric Imbalances in Soil Microbial Biomass \u2013 A Theoretical Exploration", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Microbial intracellular storage is key to defining microbial resource use strategies and could contribute to carbon (C) and nutrient cycling. However, little attention has been devoted to the role of intracellular storage in soil processes, in particular from a theoretical perspective. Here we fill this gap by integrating intracellular storage dynamics into a microbially explicit soil C and nutrient cycling model. Two ecologically relevant modes of storage are considered: reserve storage, in which elements are routed to a storage compartment in proportion to their uptake rate, and surplus storage, in which elements in excess of microbial stoichiometric requirements are stored and limiting elements are remobilized from storage to fuel growth and microbial maintenance. Our aim is to explore with this model how these different storage modes affect the retention of C and nutrients in active microbial biomass under idealized conditions mimicking a substrate pulse experiment. As a case study, we describe C and phosphorus (P) dynamics using literature data to estimate model parameters. Both storage modes enhance the retention of elements in microbial biomass, but the surplus storage mode is more effective to selectively store or remobilize C and nutrients according to microbial needs. Enhancement of microbial growth by both storage modes is largest when the substrate C:nutrient ratio is high (causing nutrient limitation after substrate addition) and the amount of added substrate is large. Moreover, storage increases biomass nutrient retention and growth more effectively when resources are supplied in a few large pulses compared to several smaller pulses (mimicking a nearly constant supply), which suggests storage to be particularly relevant in highly dynamic soil microhabitats. Overall, our results indicate that storage dynamics are most important under conditions of strong stoichiometric imbalance and may be of high ecological relevance in soil environments experiencing large variations in C and nutrient supply.</p></article>", "keywords": ["0301 basic medicine", "2. Zero hunger", "ecological stoichiometry", "nutrient limitation", "0303 health sciences", "microbial model", "Ecology", "Evolution", "15. Life on land", "surplus accumulation", "6. Clean water", "reserve storage", "03 medical and health sciences", "13. Climate action", "international", "QH359-425", "Plan_S-Compliant_OA", "QH540-549.5"]}, "links": [{"href": "https://doi.org/3202337364"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3202337364", "name": "item", "description": "3202337364", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3202337364"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-09-30T00:00:00Z"}}, {"id": "59bc71b0-75b5-4e3f-95bf-b466dc24a38b", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[9.76, 51.14], [9.76, 52.61], [12.64, 52.61], [12.64, 51.14], [9.76, 51.14]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Recycled P fertilizers; Microbial nutrient turnover; Soil nutrient stoichiometry; On-farm trials"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - InnoSoilPhos's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - InnoSoilPhos and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - InnoSoilPhos and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - InnoSoilPhos and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-08-30", "type": "Dataset", "created": "2024-07-23", "language": "eng", "title": "Effects of alternative P fertilizers on bacterial N and P turnover depend on farm specific conditions- part 1", "description": "We investigated the effects of three recycling-derived fertilizers with different P solubility on the capacity-based microbial nutrient turnover. These fertilizers were compared to conventional triple superphosphate (TSP) and no P fertilization (P0). We expected that reduced soil disturbance through deep loosening without soil turning would result in a higher abundance of bacteria involved in N and P turnover and an increased mycorrhizal colonization rate. Soil and rhizosphere samples were taken from two farms (Kiebitzbreite (KB) and Schmatzfelder Breite (SB)) in Central Germany during the 2018/2019 growing season when Triticum aestivum (cultivar Kredo at KB and Julius at SB) was cultivated at both sites. The abundance of microorganisms involved in P and nitrogen (N) turnover was determined using quantitative real-time PCR (qPCR) (gcd, phoD, pitA, pstS, AMF, apr, chiA, nxrA, nifH, AOA, AOB, nirS, nirK, nosZ). Three individual plants were excavated per plot for nucleic acid extraction. Soil firmly adhered to the roots was sampled as rhizosphere soil. Bulk soil samples (0 - 10 cm) were taken from the plants at a 10 cm horizontal distance. In total, 240 samples were collected (2 fields, 5 fertilization treatments, 2 soil compartments, 4 plot replicates with 3 plants each) and sieved to 2 mm. Our data show that the fertilization treatment had less impact on bacteria involved in P turnover but significantly affected the abundance of bacteria catalyzing key steps of the N cycle. This was particularly pronounced for SB, where higher P solubility increased the abundance of bacteria associated with N mineralization.\n\nResearch domain: Soil Sciences\n\nResearch question: None", "formats": [{"name": "CSV"}], "keywords": ["Soil", "opendata", "Recycled P fertilizers; Microbial nutrient turnover; Soil nutrient stoichiometry; On-farm trials", "Boden"], "contacts": [{"name": "Stefanie Katharina Thaqi", "organization": "Technische Universit\u00e4t M\u00fcnchen", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "stefanie.thaqi@tum.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": null}]}, {"name": "Peter Leinweber", "organization": "University of Rostock", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "peter.leinweber@uni-rostock.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0003-3776-2984", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": null, "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Stefanie Schulz", "organization": "Helmholtz Zentrum M\u00fcnchen", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "stefanie.schulz@helmholtz-muenchen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-5520-8106", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Michael Schloter", "organization": "Helmholtz Zentrum M\u00fcnchen", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "schloter@helmholtz-muenchen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0003-1671-1125", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Technische Universit\u00e4t M\u00fcnchen;Helmholtz Zentrum M\u00fcnchen", "roles": ["contributor"]}], "title_alternate": "Part 1"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=59bc71b0-75b5-4e3f-95bf-b466dc24a38b", "rel": "download"}, {"rel": "self", "type": "application/geo+json", "title": "59bc71b0-75b5-4e3f-95bf-b466dc24a38b", "name": "item", "description": "59bc71b0-75b5-4e3f-95bf-b466dc24a38b", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/59bc71b0-75b5-4e3f-95bf-b466dc24a38b"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-08-30T00:00:00Z"}}, {"id": "9dd9a649-405d-413a-ad44-d859ea084bba-envidat", "type": "Feature", "geometry": null, "properties": {"license": "http://dcat-ap.ch/vocabulary/licenses/terms_by", "updated": "2019-11-03T20:03:09Z", "type": "Dataset", "language": "en", "title": "Data Broedlin CNP", "description": "Mircocosm experiment to identify the individual patterns and controls of C, N, and P mobilization in soils under beech forests. Organic and mineral horizons sampled along a nutrient availability gradient in Germany were exposed to either permanent moist conditions or to dry spells in microcosms and quantified the release of inorganic and organic C, N, and P.", "formats": [{"name": "XLS"}], "keywords": ["carbon", "ch", "dissolved-organic-matter", "drying-rewetting", "forest", "mineralization", "nitrogen", "phosphorus", "soil", "stoichiometry"], "contacts": [{"organization": "EnviDat Support", "roles": ["creator"]}, {"organization": "https://envidat.ch/#/about", "roles": ["publisher"]}]}, "links": [{"href": "https://www.envidat.ch/#/metadata/data-broedlin-cnp"}, {"href": "https://www.envidat.ch/dataset/data-broedlin-cnp/resource/2ec747a1-3a2b-4743-b89f-db13a372c49f"}, {"href": "https://www.envidat.ch/dataset/data-broedlin-cnp/resource/c4fce049-b79d-495f-a44d-94f1d59b913a"}, {"href": "http://data.europa.eu/88u/dataset/9dd9a649-405d-413a-ad44-d859ea084bba-envidat"}, {"rel": "self", "type": "application/geo+json", "title": "9dd9a649-405d-413a-ad44-d859ea084bba-envidat", "name": "item", "description": "9dd9a649-405d-413a-ad44-d859ea084bba-envidat", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/9dd9a649-405d-413a-ad44-d859ea084bba-envidat"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"null": "date"}}, {"id": "e5e7fdc3-c724-4bca-80e6-35c82abb6da1", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[5.81, 47.26], [5.81, 54.76], [15.77, 54.76], [15.77, 47.26], [5.81, 47.26]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "carbon sequestration"}, {"id": "long-term experiments"}, {"id": "soil organic matter"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "carbon farming"}, {"id": "carbon sequestration"}, {"id": "croplands"}, {"id": "long-term experiments"}, {"id": "soil carbon"}, {"id": "nitrogen"}, {"id": "stable isotopes"}, {"id": "nutrient stoichiometry"}, {"id": "soil depth"}, {"id": "agriculture"}, {"id": "soil organic matter"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Soil3's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Soil3 and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-10-17", "type": "Dataset", "created": "2024-09-24", "language": "eng", "title": "Effects of agricultural management on the quantity and quality of soil organic matter in 0-100 cm -  data from ten German long-term experiments.   - Thuenen Soil3 Soil Organic Matter stable isotopes 8", "description": "Data on Thuenen Soil3 Soil Organic Matter stable isotopes 8\n\nGeneral description see mother table: (ad528a49-7f9e-44ae-9b77-eb7938b68f8d); Related datasets are listed in the metadata element 'Related Identifier'.\nDataset version 1.0", "formats": [{"name": "CSV"}], "keywords": ["Soil", "carbon sequestration", "long-term experiments", "soil organic matter", "opendata", "carbon farming", "carbon sequestration", "croplands", "long-term experiments", "soil carbon", "nitrogen", "stable isotopes", "nutrient stoichiometry", "soil depth", "agriculture", "soil organic matter", "Boden"], "contacts": [{"name": "Axel Don", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "axel.don@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-7046-3332", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Wulf Amelung", "organization": "University of Bonn, Institute of Crop Science and Resource Conservation (INRES)", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "wulf.amelung@uni-bonn.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4920-4667", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "ZALF", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Laura Skadell", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "laura.skadell@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4789-8474", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "roles": ["contributor"]}], "title_alternate": "Data collection: Part 8/10, table: Thuenen Soil3 Soil Organic Matter stable isotopes 8"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=e5e7fdc3-c724-4bca-80e6-35c82abb6da1", "rel": "download"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/ad528a49-7f9e-44ae-9b77-eb7938b68f8d", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "e5e7fdc3-c724-4bca-80e6-35c82abb6da1", "name": "item", "description": "e5e7fdc3-c724-4bca-80e6-35c82abb6da1", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/e5e7fdc3-c724-4bca-80e6-35c82abb6da1"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-10-17T00:00:00Z"}}, {"id": "9b5307c2-33f7-41e3-baa0-5d9b48326a22", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[5.81, 47.26], [5.81, 54.76], [15.77, 54.76], [15.77, 47.26], [5.81, 47.26]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "carbon sequestration"}, {"id": "long-term experiments"}, {"id": "soil organic matter"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "carbon farming"}, {"id": "carbon sequestration"}, {"id": "croplands"}, {"id": "long-term experiments"}, {"id": "soil carbon"}, {"id": "nitrogen"}, {"id": "stable isotopes"}, {"id": "nutrient stoichiometry"}, {"id": "soil depth"}, {"id": "agriculture"}, {"id": "soil organic matter"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Soil3's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Soil3 and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-10-17", "type": "Dataset", "created": "2024-09-24", "language": "eng", "title": "Effects of agricultural management on the quantity and quality of soil organic matter in 0-100 cm -  data from ten German long-term experiments.   - Thuenen Soil3 Soil Organic Matter quantity 5", "description": "Data on Thuenen Soil3 Soil Organic Matter quantity 5\n\nGeneral description see mother table: (https://doi.org/10.20387/bonares-cyc0-aqjx); Related datasets are listed in the metadata element 'Related Identifier'.\nDataset version 1.0", "formats": [{"name": "CSV"}], "keywords": ["Soil", "carbon sequestration", "long-term experiments", "soil organic matter", "opendata", "carbon farming", "carbon sequestration", "croplands", "long-term experiments", "soil carbon", "nitrogen", "stable isotopes", "nutrient stoichiometry", "soil depth", "agriculture", "soil organic matter", "Boden"], "contacts": [{"name": "Axel Don", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "axel.don@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-7046-3332", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Wulf Amelung", "organization": "University of Bonn, Institute of Crop Science and Resource Conservation (INRES)", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "wulf.amelung@uni-bonn.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4920-4667", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "ZALF", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Laura Skadell", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "laura.skadell@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4789-8474", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "roles": ["contributor"]}], "title_alternate": "Data collection: Part 5/10, table: Thuenen Soil3 Soil Organic Matter quantity 5"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=9b5307c2-33f7-41e3-baa0-5d9b48326a22", "rel": "download"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4d0feb39-02a1-4f98-a932-b9427526282b", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "9b5307c2-33f7-41e3-baa0-5d9b48326a22", "name": "item", "description": "9b5307c2-33f7-41e3-baa0-5d9b48326a22", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/9b5307c2-33f7-41e3-baa0-5d9b48326a22"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-10-17T00:00:00Z"}}, {"id": "f230966e-f300-4a9d-ab22-d883675fcb48", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[5.81, 47.26], [5.81, 54.76], [15.77, 54.76], [15.77, 47.26], [5.81, 47.26]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "carbon sequestration"}, {"id": "long-term experiments"}, {"id": "soil organic matter"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "carbon farming"}, {"id": "carbon sequestration"}, {"id": "croplands"}, {"id": "long-term experiments"}, {"id": "soil carbon"}, {"id": "nitrogen"}, {"id": "stable isotopes"}, {"id": "nutrient stoichiometry"}, {"id": "soil depth"}, {"id": "agriculture"}, {"id": "soil organic matter"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Soil3's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Soil3 and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-10-17", "type": "Dataset", "created": "2024-09-24", "language": "eng", "title": "Effects of agricultural management on the quantity and quality of soil organic matter in 0-100 cm -  data from ten German long-term experiments.   - Thuenen Soil3 Soil Organic Matter quantity 7", "description": "Data on Thuenen Soil3 Soil Organic Matter quantity 7\n\nGeneral description see mother table: (https://doi.org/10.20387/bonares-cyc0-aqjx); Related datasets are listed in the metadata element 'Related Identifier'.\nDataset version 1.0", "formats": [{"name": "CSV"}], "keywords": ["Soil", "carbon sequestration", "long-term experiments", "soil organic matter", "opendata", "carbon farming", "carbon sequestration", "croplands", "long-term experiments", "soil carbon", "nitrogen", "stable isotopes", "nutrient stoichiometry", "soil depth", "agriculture", "soil organic matter", "Boden"], "contacts": [{"name": "Axel Don", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "axel.don@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-7046-3332", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Wulf Amelung", "organization": "University of Bonn, Institute of Crop Science and Resource Conservation (INRES)", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "wulf.amelung@uni-bonn.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4920-4667", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "ZALF", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Laura Skadell", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "laura.skadell@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4789-8474", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "roles": ["contributor"]}], "title_alternate": "Data collection: Part 7/10, table: Thuenen Soil3 Soil Organic Matter quantity 7"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=f230966e-f300-4a9d-ab22-d883675fcb48", "rel": "download"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4d0feb39-02a1-4f98-a932-b9427526282b", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "f230966e-f300-4a9d-ab22-d883675fcb48", "name": "item", "description": "f230966e-f300-4a9d-ab22-d883675fcb48", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/f230966e-f300-4a9d-ab22-d883675fcb48"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-10-17T00:00:00Z"}}, {"id": "PMC9152356", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-06-23T16:29:51Z", "type": "Journal Article", "created": "2022-05-17", "title": "Interacting Bioenergetic and Stoichiometric Controls on Microbial Growth", "description": "<p>Microorganisms function as open systems that exchange matter and energy with their surrounding environment. Even though mass (carbon and nutrients) and energy exchanges are tightly linked, there is a lack of integrated approaches that combine these fluxes and explore how they jointly impact microbial growth. Such links are essential to predicting how the growth rate of microorganisms varies, especially when the stoichiometry of carbon- (C) and nitrogen (N)-uptake is not balanced. Here, we present a theoretical framework to quantify the microbial growth rate for conditions of C-, N-, and energy-(co-) limitations. We use this framework to show how the C:N ratio and the degree of reduction of the organic matter (OM), which is also the electron donor, availability of electron acceptors (EAs), and the different sources of N together control the microbial growth rate under C, nutrient, and energy-limited conditions. We show that the growth rate peaks at intermediate values of the degree of reduction of OM under oxic and C-limited conditions, but not under N-limited conditions. Under oxic conditions and with N-poor OM, the growth rate is higher when the inorganic N (NInorg)-source is ammonium compared to nitrate due to the additional energetic cost involved in nitrate reduction. Under anoxic conditions, when nitrate is both EA and NInorg-source, the growth rates of denitrifiers and microbes performing the dissimilatory nitrate reduction to ammonia (DNRA) are determined by both OM degree of reduction and nitrate-availability. Consistent with the data, DNRA is predicted to foster growth under extreme nitrate-limitation and with a reduced OM, whereas denitrifiers are favored as nitrate becomes more available and in the presence of oxidized OM. Furthermore, the growth rate is reduced when catabolism is coupled to low energy yielding EAs (e.g., sulfate) because of the low carbon use efficiency (CUE). However, the low CUE also decreases the nutrient demand for growth, thereby reducing N-limitation. We conclude that bioenergetics provides a useful conceptual framework for explaining growth rates under different metabolisms and multiple resource-limitations.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "0303 health sciences", "denitrification", "660", "nitrogen limitation", "microbial growth", "Biological Sciences", "bioenergetics", "Microbiology", "QR1-502", "6. Clean water", "stoichiometry", "DNRA", "thermodynamics", "03 medical and health sciences", "Geovetenskap och relaterad milj\u00f6vetenskap", "Microbiology (Microbiology in the medical area to be 30109)", "13. Climate action", "Biologiska vetenskaper", "Bioenergy", "Earth and Related Environmental Sciences", "energy limitation"]}, "links": [{"href": "https://pub.epsilon.slu.se/28342/1/chakrawal-a-et-al-220615.pdf"}, {"href": "https://doi.org/PMC9152356"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "PMC9152356", "name": "item", "description": "PMC9152356", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/PMC9152356"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-05-17T00:00:00Z"}}, {"id": "ad528a49-7f9e-44ae-9b77-eb7938b68f8d", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[5.81, 47.26], [5.81, 54.76], [15.77, 54.76], [15.77, 47.26], [5.81, 47.26]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "carbon sequestration"}, {"id": "long-term experiments"}, {"id": "soil organic matter"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "carbon farming"}, {"id": "carbon sequestration"}, {"id": "croplands"}, {"id": "long-term experiments"}, {"id": "soil carbon"}, {"id": "nitrogen"}, {"id": "stable isotopes"}, {"id": "nutrient stoichiometry"}, {"id": "soil depth"}, {"id": "agriculture"}, {"id": "soil organic matter"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Soil3's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Soil3 and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-10-17", "type": "Dataset", "created": "2024-09-24", "language": "eng", "title": "Effects of agricultural management on the quantity and quality of soil organic matter in 0-100 cm -  data from ten German long-term experiments.  - Thuenen Soil3 Soil Organic Matter stable isotopes 1", "description": "Agricultural management can influence the quantity and quality of soil organic matter (SOM), thereby contributing to carbon (C) sequestration and climate change mitigation. The depth to which agricultural management practices affect SOM is uncertain. Soil depth can have an important influence on SOM dynamics, so it is important to consider depth effects to fully account for changes, particularly in soil organic C (SOC) stocks. This is particularly true when assessing C faming measures, which are becoming increasingly important due to climate change. We sampled and analysed the top metre of mineral arable soils from ten long-term experiments (LTEs) in Germany to quantify and qualify the depth-dependent effects on SOC stocks, C and nitrogen (N) content, the \u03b413C and \u03b415N signature and the C/N ratio of the soils due to common agricultural management practices: Mineral N fertilisation (only for SOC stocks), a combination of N, phosphorus (P) and potassium (K) fertilisation, irrigation, crop rotation with legumes, straw incorporation, farmyard manure (FYM) application, liming and reduced tillage. In addition, the effects of soil compaction (only for the SOC stocks) were analysed as a negative side-effect of agricultural management. The dataset includes metadata and research data on soil properties at 0-100 cm, e.g., mean annual temperature and precipitation, C and N content, SOC stocks, water content, texture data (sand, silt, clay), pH, \u03b413C and \u03b415N values. This table contains Data on Thuenen Soil3 Soil Organic Matter stable isotope 1.\n\nRelated datasets are listed in the metadata element 'Related Identifier'.\nDataset version 1.0", "formats": [{"name": "CSV"}], "keywords": ["Soil", "carbon sequestration", "long-term experiments", "soil organic matter", "opendata", "carbon farming", "carbon sequestration", "croplands", "long-term experiments", "soil carbon", "nitrogen", "stable isotopes", "nutrient stoichiometry", "soil depth", "agriculture", "soil organic matter", "Boden"], "contacts": [{"name": "Axel Don", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "axel.don@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-7046-3332", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Wulf Amelung", "organization": "University of Bonn, Institute of Crop Science and Resource Conservation (INRES)", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "wulf.amelung@uni-bonn.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4920-4667", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "ZALF", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Laura Skadell", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "laura.skadell@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4789-8474", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "roles": ["contributor"]}], "title_alternate": "Data collection: Part 1/10, table: Thuenen Soil3 Soil Organic Matter stable isotopes 1"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=ad528a49-7f9e-44ae-9b77-eb7938b68f8d", "rel": "download"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/ad528a49-7f9e-44ae-9b77-eb7938b68f8d", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "ad528a49-7f9e-44ae-9b77-eb7938b68f8d", "name": "item", "description": "ad528a49-7f9e-44ae-9b77-eb7938b68f8d", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/ad528a49-7f9e-44ae-9b77-eb7938b68f8d"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-10-17T00:00:00Z"}}, {"id": "ba0e2b40-fb8c-4f50-bb5c-3e8709f733eb", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[8.92, 50.14], [8.92, 53.0], [14.0, 53.0], [14.0, 50.14], [8.92, 50.14]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata; Recycled P fertilizers; Microbial nutrient turnover; Soil nutrient stoichiometry; On-farm trials"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - InnoSoilPhos's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - InnoSoilPhos and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - InnoSoilPhos and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - InnoSoilPhos and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-08-30", "type": "Dataset", "created": "2024-07-23", "language": "eng", "title": "Effects of alternative P fertilizers on bacterial N and P turnover depend on farm specific conditions - Part 2", "description": "We investigated the effects of three recycling-derived fertilizers with different P solubility on the capacity-based microbial nutrient turnover. These fertilizers were compared to conventional triple superphosphate (TSP) and no P fertilization (P0). We expected that reduced soil disturbance through deep loosening without soil turning would result in a higher abundance of bacteria involved in N and P turnover and an increased mycorrhizal colonization rate. Soil and rhizosphere samples were taken from two farms (Kiebitzbreite (KB) and Schmatzfelder Breite (SB)) in Central Germany during the 2018/2019 growing season when Triticum aestivum (cultivar Kredo at KB and Julius at SB) was cultivated at both sites. The abundance of microorganisms involved in P and nitrogen (N) turnover was determined using quantitative real-time PCR (qPCR) (gcd, phoD, pitA, pstS, AMF, apr, chiA, nxrA, nifH, AOA, AOB, nirS, nirK, nosZ). Three individual plants were excavated per plot for nucleic acid extraction. Soil firmly adhered to the roots was sampled as rhizosphere soil. Bulk soil samples (0 - 10 cm) were taken from the plants at a 10 cm horizontal distance. In total, 240 samples were collected (2 fields, 5 fertilization treatments, 2 soil compartments, 4 plot replicates with 3 plants each) and sieved to 2 mm. Our data show that the fertilization treatment had less impact on bacteria involved in P turnover but significantly affected the abundance of bacteria catalyzing key steps of the N cycle. This was particularly pronounced for SB, where higher P solubility increased the abundance of bacteria associated with N mineralization.\n\nResearch domain: Soil Sciences\n\nResearch question: None", "formats": [{"name": "CSV"}], "keywords": ["Soil", "opendata; Recycled P fertilizers; Microbial nutrient turnover; Soil nutrient stoichiometry; On-farm trials", "Boden"], "contacts": [{"name": "Stefanie Katharina Thaqi", "organization": "Technische Universit\u00e4t M\u00fcnchen,", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "stefanie.thaqi@tum.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0009-0009-4009-9790", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Peter Leinweber", "organization": "University of Rostock", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "peter.leinweber@uni-rostock.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": null}]}, {"name": "ZALF", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Stefanie Schulz", "organization": "Helmholtz Zentrum M\u00fcnchen", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "stefanie.schulz@helmholtz-muenchen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-5520-8106", "name_url": "", "description": "orcid", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Michael Schloter", "organization": "Helmholtz Zentrum M\u00fcnchen", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "schloter@helmholtz-muenchen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0003-1671-1125", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Technische Universit\u00e4t M\u00fcnchen,;Helmholtz Zentrum M\u00fcnchen", "roles": ["contributor"]}], "title_alternate": "Part 2"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=ba0e2b40-fb8c-4f50-bb5c-3e8709f733eb", "rel": "download"}, {"rel": "self", "type": "application/geo+json", "title": "ba0e2b40-fb8c-4f50-bb5c-3e8709f733eb", "name": "item", "description": "ba0e2b40-fb8c-4f50-bb5c-3e8709f733eb", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/ba0e2b40-fb8c-4f50-bb5c-3e8709f733eb"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-08-30T00:00:00Z"}}, {"id": "4d0feb39-02a1-4f98-a932-b9427526282b", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[5.81, 47.26], [5.81, 54.76], [15.77, 54.76], [15.77, 47.26], [5.81, 47.26]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "carbon sequestration"}, {"id": "long-term experiments"}, {"id": "soil organic matter"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "carbon farming"}, {"id": "carbon sequestration"}, {"id": "croplands"}, {"id": "long-term experiments"}, {"id": "soil carbon"}, {"id": "nitrogen"}, {"id": "stable isotopes"}, {"id": "nutrient stoichiometry"}, {"id": "soil depth"}, {"id": "agriculture"}, {"id": "soil organic matter"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Soil3's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Soil3 and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Soil3 and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-10-17", "type": "Dataset", "created": "2024-09-24", "language": "eng", "title": "Effects of agricultural management on the quantity and quality of soil organic matter in 0-100 cm -  data from ten German long-term experiments.   - Thuenen Soil3 Soil Organic Matter quantity 1", "description": "Agricultural management can influence the quantity and quality of soil organic matter (SOM), thereby contributing to carbon (C) sequestration and climate change mitigation. The depth to which agricultural management practices affect SOM is uncertain. Soil depth can have an important influence on SOM dynamics, so it is important to consider depth effects to fully account for changes, particularly in soil organic C (SOC) stocks. This is particularly true when assessing C faming measures, which are becoming increasingly important due to climate change. We sampled and analysed the top metre of mineral arable soils from ten long-term experiments (LTEs) in Germany to quantify and qualify the depth-dependent effects on SOC stocks, C and nitrogen (N) content, the \u03b413C and \u03b415N signature and the C/N ratio of the soils due to common agricultural management practices: Mineral N fertilisation (only for SOC stocks), a combination of N, phosphorus (P) and potassium (K) fertilisation, irrigation, crop rotation with legumes, straw incorporation, farmyard manure (FYM) application, liming and reduced tillage. In addition, the effects of soil compaction (only for the SOC stocks) were analysed as a negative side-effect of agricultural management. The dataset includes metadata and research data on soil properties at 0-100 cm, e.g., mean annual temperature and precipitation, C and N content, SOC stocks, water content, texture data (sand, silt, clay), pH, \u03b413C and \u03b415N values. This table contains Data on Thuenen Soil3 Soil Organic Matter quantity 1.\n\nRelated datasets are listed in the metadata element 'Related Identifier'.\nDataset version 1.0", "formats": [{"name": "CSV"}], "keywords": ["Soil", "carbon sequestration", "long-term experiments", "soil organic matter", "opendata", "carbon farming", "carbon sequestration", "croplands", "long-term experiments", "soil carbon", "nitrogen", "stable isotopes", "nutrient stoichiometry", "soil depth", "agriculture", "soil organic matter", "Boden"], "contacts": [{"name": "Axel Don", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "axel.don@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0001-7046-3332", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Wulf Amelung", "organization": "University of Bonn, Institute of Crop Science and Resource Conservation (INRES)", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "wulf.amelung@uni-bonn.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4920-4667", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "ZALF", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Laura Skadell", "organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "laura.skadell@thuenen.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-4789-8474", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Th\u00fcnen-Institute of Climate-Smart Agriculture", "roles": ["contributor"]}], "title_alternate": "Data collection: Part 1/10, table: Thuenen Soil3 Soil Organic Matter quantity 1"}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4d0feb39-02a1-4f98-a932-b9427526282b", "rel": "download"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4d0feb39-02a1-4f98-a932-b9427526282b", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "4d0feb39-02a1-4f98-a932-b9427526282b", "name": "item", "description": "4d0feb39-02a1-4f98-a932-b9427526282b", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4d0feb39-02a1-4f98-a932-b9427526282b"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-10-17T00:00:00Z"}}, {"id": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[6.16, 50.16], [6.16, 51.32], [7.61, 51.32], [7.61, 50.16], [6.16, 50.16]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "GEMET - Concepts, version 2.4"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Inplamint's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Inplamint and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-04-15", "type": "Dataset", "created": "2023-01-24", "language": "eng", "title": "Soil fungal community across a 52-year chronosequence of soil recultivation after open-mining in Inden, Germany", "description": "The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6\u00b015\u20190\u2019 E to 6\u00b021\u20190\u2019 E and 50\u00b050\u20195\u2019 N to 50\u00b053\u20190\u2019 N) of an open-cast lignite mine at Inden, between Cologne, Aachen, M\u00f6nchengladbach, and D\u00fcsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years, at samling time of 2016. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha\u22121 a\u22121 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). They are a total of 115 samples (5 replicates per field x 2 seasons, each field corresponds to a year of recultivation). Four samples were removed due to failed PCR. The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5\u2032\u2010GTGARTCATCGAATCTTTG\u20103\u2032 / ITS4: 5\u2032\u2010TCCTCCGCTTATTGATATGC\u20103\u2032). Amplicon sequence variants (ASVs) were inferred using DADA2 in R. Taxonomic annotations were performed using the IDTaxa algorithm implemented in the DECIPHER R package, against UNITE (version of 10.05.2021). Raw sequencing reads are available at ENA under study project PRJEB51095. The DNA sequences of the fungal amplicon sequence variants are available at ENA under accession numbers OV986018-OV989728. The processed dataset including the ASV count table, ASV taxonomy, and sample metadata compiled as a phyloseq R object stored in a single .RDS R file, as well as ASV guild annotation using Funguild database, are available at figshare at (https://doi.org/10.6084/m9.figshare.20160578). To read the data in the software R, use readRDS() function). Here we upload at the BONARES data centre the relative abundance of each fungal guild (% of DNA sequences) per samples along with basic metadata for easy reuse. The guild name and metadata name is provided in the header of each column. The entire set of measured soil physico-chemical parameters has been deposited at BONARES under reference 72ca6e98-5aab-4884-bf1b-56931482eb94. The publication associated to the dataset can be found at https://doi.org/10.1007/s00248-022-02058-w. Roy J, Reichel R, Br\u00fcggemann N, Rillig MC. 2022. Functional, not Taxonomic, Composition of Soil Fungi Reestablishes to Pre   mining Initial State After 52 Years of Recultivation. Microbial Ecology. Other publications associated to the datasets are : (1) Reichel R., H\u00e4nsch M., Br\u00fcggemann N. (2017). Indication of rapid soil food web recovery by nematode-derived indices in restored agricultural soil after open-cast lignite mining. Soil Biology and Biochemistry, 115, 261-264. DOI: 10.1016/j.soilbio.2017.08.020; (2) Roy J., Reichel R., Br\u00fcggemann N., Hempel S., Rillig M. (2017). Succession of arbuscular mycorrhizal fungi along a 52-years agricultural recultivation chronosequence. FEMS Microbiology Ecology. DOI: 1093/femsec/fix102", "formats": [{"name": "CSV"}], "keywords": ["Soil", "agriculture", "microbiology", "opendata", "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic", "Boden", "agriculture", "microbiology"], "contacts": [{"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "BonaRes Data Center", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Matthias Rillig", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "rrillig@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3541-7853", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Freie Universit\u00e4t Berlin;Forschungszentrum J\u00fclich GmbH", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4cf3c473-96a6-4660-b973-30c0f03c7cd2", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure1.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure2.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure3.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "name": "item", "description": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4cf3c473-96a6-4660-b973-30c0f03c7cd2"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-04-15T00:00:00Z"}}], "links": [{"rel": "self", "type": "application/geo+json", "title": "This document as GeoJSON", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=STOICHIOMETRY&f=json", "hreflang": "en-US"}, {"rel": "alternate", "type": "text/html", "title": "This document as HTML", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=STOICHIOMETRY&f=html", "hreflang": "en-US"}, {"rel": "collection", "type": "application/json", "title": "Collection URL", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main", "hreflang": "en-US"}, {"type": "application/geo+json", "rel": "first", "title": "items (first)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=STOICHIOMETRY&", "hreflang": "en-US"}, {"rel": "last", "type": "application/geo+json", "title": "items (last)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=STOICHIOMETRY&offset=49", "hreflang": "en-US"}], "numberMatched": 49, "numberReturned": 49, "distributedFeatures": [], "timeStamp": "2026-06-24T02:22:12.396147Z"}