{"type": "FeatureCollection", "features": [{"id": "10.1007/s004420050581", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:14:50Z", "type": "Journal Article", "created": "2002-08-25", "title": "Responses Of Communities Of Tropical Tree Species To Elevated Co2 In A Forest Clearing", "description": "Communities of ten species of tropical forest tree seedlings from three successional classes were grown at ambient and elevated CO2 in large open-top chambers on the edge of a forest in Panam\u00e1. Communities grew from 20\u2009cm to approximately 2\u2009m in height in 6 months. No enhancements in plant biomass accumulation occurred under elevated CO2 either in the whole communities or in growth of individual species. Reductions in leaf area index under elevated CO2 were observed, as were decreases in leaf nitrogen concentrations and increases in the C:N ratio of leaf tissue. Species tended to respond individualistically to elevated CO2, but some generalizations of how successional groupings responded could be made. Early and mid-successional species generally showed greater responses to elevated CO2 than late-successional species, particularly with respect to increases in photosynthetic rates and leaf starch concentrations, and reductions in leaf area ratio. Late-successional species showed greater increases in C:N ratios in response to elevated CO2 than did other species. Our results indicate that there may not be an increase in the growth of regenerating tropical forest under elevated CO2, but that there could be changes in soil nutrient availability because of reductions in leaf tissue quality, particularly in late-successional species.", "keywords": ["Successional status", "0106 biological sciences", "Biomass allocation", "Leaf chemistry", "1060 Biologie", "Elevated CO2", "Tropical forest tree species", "1060 Biology", "15. Life on land", "2303 Ecology", "01 natural sciences"]}, "links": [{"href": "https://doi.org/10.1007/s004420050581"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Oecologia", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s004420050581", "name": "item", "description": "10.1007/s004420050581", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s004420050581"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "1998-08-10T00:00:00Z"}}, {"id": "10.1007/s10021-006-9010-y", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:14:52Z", "type": "Journal Article", "created": "2007-04-18", "title": "Land-Use Intensity Effects On Soil Organic Carbon Accumulation Rates And Mechanisms", "description": "Restoring soil C pools by reducing land use intensity is a potentially high impact, rapidly deployable strategy for partially offsetting atmospheric CO2 increases. However, rates of C accumulation and underlying mechanisms have rarely been determined for a range of managed and successional ecosystems on the same soil type. We determined soil organic matter (SOM) fractions with the highest potential for sequestering C in ten ecosystems on the same soil series using both density- and incubation-based fractionation methods. Ecosystems included four annual row-crop systems (conventional, low input,  organic and no-till), two perennial cropping systems (alfalfa and poplar), and four native ecosystems (early successional, midsuccessional historically tilled, midsuccessional never-tilled, and late successional forest). Enhanced C storage to 5\u00a0cm relative to conventional agriculture ranged from 8.9\u00a0g\u00a0C\u00a0m\u22122\u00a0y\u22121 in low input row crops to 31.6\u00a0g\u00a0C\u00a0m\u22122\u00a0y\u22121 in the early successional ecosystem. Carbon sequestration across all ecosystems occurred in aggregate-associated pools larger than 53\u00a0\u03bcm. The density-based fractionation scheme identified heavy-fraction C pools (SOM\u00a0>\u00a01.6\u00a0g\u00a0cm\u22123 plus SOM\u00a0 250\u00a0\u03bcm), as having the highest potential C accumulation rates, ranging from 8.79 g\u00a0C\u00a0m\u22122\u00a0y\u22121 in low input row crops to 29.22\u00a0g\u00a0C\u00a0m\u22122\u00a0y\u22121 in the alfalfa ecosystem. Intra-aggregate light fraction pools accumulated C at slower rates, but generally faster than in inter-aggregate LF pools. Incubation-based methods that fractionated soil into active, slow and passive pools showed that C accumulated primarily in slow and resistant pools. However, crushing aggregates in a manner that simulates tillage resulted in a substantial transfer of C from slow pools with field mean residence times of decades to active pools with mean residence times of only weeks. Our results demonstrate that soil C accumulates almost entirely in soil aggregates, mostly in macroaggregates, following reductions in land use intensity. The potentially rapid destruction of macroaggregates following tillage, however, raises concerns about the long-term persistence of these C pools.", "keywords": ["2. Zero hunger", "forest C", "13. Climate action", "organic", "aggregates", "tillage", "0401 agriculture", " forestry", " and fisheries", "04 agricultural and veterinary sciences", "Biogeochemistry", "15. Life on land", "C-sequestration", "agriculture", "succession"]}, "links": [{"href": "https://doi.org/10.1007/s10021-006-9010-y"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecosystems", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s10021-006-9010-y", "name": "item", "description": "10.1007/s10021-006-9010-y", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s10021-006-9010-y"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2007-02-01T00:00:00Z"}}, {"id": "10.1007/s100210000025", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:14:55Z", "type": "Journal Article", "created": "2002-07-25", "title": "Controls On Soil Carbon Dioxide And Methane Fluxes In A Variety Of Taiga Forest Stands In Interior Alaska", "description": "CO2 and CH4 fluxes were monitored over 4 years in a range of taiga forests along the Tanana River in interior Alaska. Floodplain alder and white spruce sites and upland birch/aspen and white spruce sites were examined. Each site had control, fertilized, and sawdust amended plots; flux measurements began during the second treatment year. CO2 emissions decreased with successional age across the sites (alder, birch/aspen, and white spruce, in order of succession) regardless of landscape position. Although CO2 fluxes showed an exponential relationship with soil temperature, the response of CO2 production to moisture fit an asymptotic model. Of the manipulations, only N fertilization had an effect on CO2 flux, decreasing flux in the floodplain sites but increasing it in the birch/aspen site. Landscape position was the best predictor of CH4 flux. The two upland sites consumed CH4 at similar rates (approximately 0.5 mg C m\u22122 d\u22121), whereas the floodplain sites had lower consumption rates (0\u20130.3 mg C m\u22122 d\u22121). N fertilization and sawdust both inhibited CH4 consumption in the upland birch/aspen and floodplain spruce sites but not in the upland spruce site. The biological processes driving CO2 fluxes were sensitive to temperature, moisture, and vegetation, whereas CH4 fluxes were sensitive primarily to landscape position and biogeochemical disturbances. Hence, climate change effects on C-gas flux in taiga forest soils will depend on the relationship between soil temperature and moisture and the concomitant changes in soil nutrient pools and cycles.", "keywords": ["landscape-ecology", "Betulaceae-: Dicotyledones-", "flux-", "soil-nutrient-pools", "Coniferopsida-: Gymnospermae-", "Vascular-Plants", "forests-", "Environmental-Sciences)", "carbon-dioxide", "nitrogen-fertilizers", "01 natural sciences", "carbon-dioxide: emissions-", "nitrogen-: fertilization-", "vegetation-", "birch- (Betulaceae-)", "124-38-9: CARBON DIOXIDE", "Spermatophytes-", "Spermatophyta-", "74-82-8: METHANE", "Plantae-", "white-spruce (Coniferopsida-)", "successional-age", "boreal-forests", "environmental-temperature", "0105 earth and related environmental sciences", "taiga-forest-stands", "Angiosperms-", "Gymnosperms-", "Angiospermae-", "Plants-", "sawdust-", "methane-", "15. Life on land", "North-America", "Nearctic-region)", "floodplains-", "mathematical-models", "13. Climate action", "alder- (Betulaceae-)", "upland-sites", "Alaska- (USA-", "climate-change", "Terrestrial-Ecology (Ecology-", "7727-37-9: NITROGEN", "Dicots-", "methane-: consumption-", "moisture-", "climatic-change", "temperature-"]}, "links": [{"href": "https://doi.org/10.1007/s100210000025"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecosystems", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s100210000025", "name": "item", "description": "10.1007/s100210000025", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s100210000025"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2000-05-10T00:00:00Z"}}, {"id": "10.1007/s11852-014-0333-0", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:15:31Z", "type": "Journal Article", "created": "2014-07-09", "title": "Utilisation Of A Coastal Grassland By Geese After Managed Re-Alignment", "description": "<p>In this study we evaluate the effect of coastal re-alignment on the utilisation of coastal grasslands by staging geese. We assessed vegetation change and utilisation by geese using repeated mapping and regular dropping counts in both the restored marsh and adjacent reference sites. All measurements were started well before the actual re-alignment. In addition, we studied the effects of livestock grazing on vegetation and geese, using exclosures. The vegetation transformed from fresh grassland into salt-marsh vegetation. A relatively large proportion of the de-embanked area became covered with secondary pioneer vegetation, and the overall cover of potential food plants for geese declined. Goose utilisation had initially dropped to low levels, both in autumn and in spring, but it recovered to a level comparable to the reference marsh after ten years. Exclosure experiments revealed that livestock grazing prevented the establishment of closed swards of grass in the poorly drained lower area of the restored marsh, and thereby negatively affected goose utilisation of these areas during spring staging. Goose grazing in the restored marsh during spring showed a positive numerical response to grass cover found during the preceding growing season. (1) The value of restored salt marsh as foraging habitat for geese initially decreased after managed re-alignment but recovered after ten years. (2) Our findings support the idea that the value of foraging habitats depends largely on the cover of forage plants and that this can be manipulated by adjusting both grazing and drainage.</p>", "keywords": ["0106 biological sciences", "Dark-bellied Brent geese", "Barnacle geese", "Livestock grazing", "Salt-marsh restoration", "ENGLAND", "SALT-MARSH RESTORATION", "PATTERNS", "WADDEN SEA", "15. Life on land", "TERM", "VEGETATION SUCCESSION", "01 natural sciences"]}, "links": [{"href": "https://doi.org/10.1007/s11852-014-0333-0"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20of%20Coastal%20Conservation", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1007/s11852-014-0333-0", "name": "item", "description": "10.1007/s11852-014-0333-0", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1007/s11852-014-0333-0"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2014-07-10T00:00:00Z"}}, {"id": "10.1016/j.baae.2006.08.008", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:16:01Z", "type": "Journal Article", "created": "2007-02-21", "title": "Time-Scale Effects In The Interaction Between A Large And A Small Herbivore", "description": "<p>In the short term, grazing will mainly affect plant biomass and forage quality. However, grazing can affect plant species composition by accelerating or retarding succession at longer time-scales. Few studies concerning interactions among herbivores have taken the change in plant species composition into account. In a salt-marsh system, the longterm effects of exclusion of a large herbivore (cattle) on the abundance of a small herbivore (hare) were studied. Excluding cattle grazing for 30 years resulted in large changes in vegetation composition. In general, the cover of tall-growing species increased in the absence of cattle grazing. These long-term changes negatively affected hare grazing intensity. Hares preferentially fed on Festuca rubra and negatively selected tall growing plants, such as Elymus athericus, both in cattle-grazed and long-term ungrazed areas. However, the intensity of hare grazing was not related to the cover of F rubra. The cover of tall-growing plants (E athericus, A triplex prostrata and Juncus maritimus) appeared to be the best predictor and hare grazing intensity decreased sharply with an increase of the cover of tall plants. When cover of tall plants did not increase, hare grazing intensity was not affected. The study shows that the time-scale of the experiment is of prime importance in studying interactions between herbivores. Species that do not seem to influence the abundance of one another or are competing for the same resources on a short time-scale might well be facilitating each other when looking at larger time-scales while taking plant species replacement into account. (c) 2007 Gesellschaft fur Okologie. Published by Elsevier GrnbH. All rights reserved.</p>", "keywords": ["0106 biological sciences", "Lepus europaeus", "productivity", "SUCCESSION", "COMPETITION", "brown hares", "barnacle geese", "HARES LEPUS-EUROPAEUS", "BARNACLE GEESE", "01 natural sciences", "facilitation", "SALT-MARSH", "MANAGEMENT", "BROWN HARES", "tall plants", "2. Zero hunger", "exclosures", "15. Life on land", "FACILITATION", "succession", "communities", "salt marsh", "hares lepus-europaeus", "salt-marsh", "13. Climate action", "mountain hares", "MOUNTAIN HARES", "COMMUNITIES", "competition", "management"]}, "links": [{"href": "https://doi.org/10.1016/j.baae.2006.08.008"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Basic%20and%20Applied%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.baae.2006.08.008", "name": "item", "description": "10.1016/j.baae.2006.08.008", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.baae.2006.08.008"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2008-03-01T00:00:00Z"}}, {"id": "10.1016/j.ecss.2013.08.021", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:16:17Z", "type": "Journal Article", "created": "2013-08-20", "title": "Effects Of Long-Term Grazing On Sediment Deposition And Salt-Marsh Accretion Rates", "description": "<p>Many studies have attempted to predict whether coastal marshes will be able to keep up with future acceleration of sea-level rise by estimating marsh accretion rates. However, there are few studies focussing on the long-term effects of herbivores on vegetation structure and subsequent effects on marsh accretion. Deposition of fine-grained, mineral sediment during tidal inundations, together with organic matter accumulation from the local vegetation, positively affects accretion rates of marsh surfaces. Tall vegetation can enhance sediment deposition by reducing current flow and wave action. Herbivores shorten vegetation height and this could potentially reduce sediment deposition. This study estimated the effects of herbivores on 1) vegetation height, 2) sediment deposition and 3) resulting marsh accretion after long-term (at least 16 years) herbivore exclusion of both small (i.e. hare and goose) and large grazers (i.e. cattle) for marshes of different ages. Our results firstly showed that both small and large herbivores can have a major impact on vegetation height. Secondly, grazing processes did not affect sediment deposition. Finally, trampling by large grazers affected marsh accretion rates by compacting the soil. In many European marshes, grazing is used as a tool in nature management as well as for agricultural purposes. Thus, we propose that soil compaction by large grazers should be taken in account when estimating the ability of coastal systems to cope with an accelerating sea-level rise. (C) 2013 Elsevier Ltd. All rights reserved.</p>", "keywords": ["marsh succession", "0106 biological sciences", "Surface elevation change", "Sea-level rise", "FLOW", "Sedimentation rate", "SEA-LEVEL RISE", "SURFACE ELEVATION", "01 natural sciences", "BROWN HARES", "Herbivory", "14. Life underwater", "Marsh succession", "Biology", "Global change", "VEGETATION SUCCESSION", "global change", "COASTAL WETLANDS", "0105 earth and related environmental sciences", "2. Zero hunger", "sedimentation rate", "herbivory", "GEESE", "sea-level rise", "15. Life on land", "PRODUCTIVITY GRADIENT", "surface elevation change", "NORTH-SEA", "13. Climate action", "TIDAL MARSH"]}, "links": [{"href": "https://doi.org/10.1016/j.ecss.2013.08.021"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Estuarine%2C%20Coastal%20and%20Shelf%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.ecss.2013.08.021", "name": "item", "description": "10.1016/j.ecss.2013.08.021", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.ecss.2013.08.021"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2013-11-01T00:00:00Z"}}, {"id": "10.1016/j.foreco.2011.06.036", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:16:37Z", "type": "Journal Article", "created": "2011-07-27", "title": "Carbon Accumulation In The Biomass And Soil Of Different Aged Secondary Forests In The Humid Tropics Of Costa Rica", "description": "Open AccessMinisterio de Ciencia y Tecnolog\u00eda, Costa Rica", "keywords": ["0106 biological sciences", "NATURAL REGENERATION", "PLANTACIONES", "Carbon pools", "Tree plantations", "Biomass models", "ARBOLES", "NATURAL RESERVES", "15. Life on land", "01 natural sciences", "Environmental science", "BIOMASS", "CARBON", "PLANTATIONS", "RESERVAS NATURALES", "Medio Ambiente", "REGENERACION NATURAL", "TREES", "CARBONO", "Succession age", "Natural regeneration", "BIOMASA"]}, "links": [{"href": "https://doi.org/10.1016/j.foreco.2011.06.036"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Forest%20Ecology%20and%20Management", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.foreco.2011.06.036", "name": "item", "description": "10.1016/j.foreco.2011.06.036", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.foreco.2011.06.036"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2011-10-01T00:00:00Z"}}, {"id": "10.1016/j.jnc.2004.10.001", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:17:00Z", "type": "Journal Article", "created": "2005-08-18", "title": "Utilisation Of Wadden Sea Salt Marshes By Geese In Relation To Livestock Grazing", "description": "To arctic breeding geese, the salt marshes of the International Wadden Sea are important spring staging areas. Many of these marshes have always been grazed with livestock (mainly cattle and sheep). To evaluate the influence of livestock grazing on composition and structure of salt-marsh communities and its consequences for habitat use by geese, a total of 17 pairs of grazed and ungrazed marshes were visited both in April and May 1999, and the accumulated grazing pressure by geese was estimated using dropping counts. Observed grazing pressure was related to management status and to relevant vegetation parameters. The intensity of livestock grazing influences the vegetation on the marsh. Salt marshes that are not grazed by livestock are characterised by stands with a taller canopy, a lower cover of grasses preferred by geese, and a higher cover of plants that are not preferred. Overall goose-dropping densities are significantly lower in ungrazed marshes compared to marshes grazed by livestock. Some ungrazed marshes had comparatively high goose grazing pressure, and these were all natural marshes on a sandy soil, or artificial mainland marshes with a recent history of intensive livestock grazing. Goose grazing is associated with a short canopy. The plant communities with short canopy, dominated by Agrostis stolonifera, Festuca rubra and Puccinellia maritima, together account for 85% of all goose droppings in our data. The sites that were not visited by geese differed very little from those that were visited, in the parameters we measured. This might indicate that there was no shortage of available habitat for spring staging geese in the Wadden Sea, in the study period.", "keywords": ["0106 biological sciences", "Hare", "Habitat-use", "Grazing pressure", "Barnacle Goose", "13. Climate action", "Vegetation-succession", "Brent Goose", "14. Life underwater", "15. Life on land", "01 natural sciences"]}, "links": [{"href": "https://doi.org/10.1016/j.jnc.2004.10.001"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20for%20Nature%20Conservation", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.jnc.2004.10.001", "name": "item", "description": "10.1016/j.jnc.2004.10.001", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.jnc.2004.10.001"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2005-06-01T00:00:00Z"}}, {"id": "10.1111/1462-2920.16268", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:19:18Z", "type": "Journal Article", "created": "2022-11-03", "title": "Environmental micro\u2010niche filtering shapes bacterial pioneer communities during primary colonization of a Himalayas' glacier forefield", "description": "Abstract<p>The pedogenesis from the mineral substrate released upon glacier melting has been explained with the succession of consortia of pioneer microorganisms, whose structure and functionality are determined by the environmental conditions developing in the moraine. However, the microbiome variability that can be expected in the environmentally heterogeneous niches occurring in a moraine at a given successional stage is poorly investigated. In a 50\uffe2\uff80\uff89m2 area in the forefield of the Lobuche glacier (Himalayas, 5050\uffe2\uff80\uff89m above sea level), we studied six sites of primary colonization presenting different topographical features (orientation, elevation and slope) and harbouring greyish/dark biological soil crusts (BSCs). The spatial vicinity of the sites opposed to their topographical differences, allowed us to examine the effect of environmental conditions independently from the time of deglaciation. The bacterial microbiome diversity and their co\uffe2\uff80\uff90occurrence network, the bacterial metabolisms predicted from 16S rRNA gene high\uffe2\uff80\uff90throughput sequencing, and the microbiome intact polar lipids were investigated in the BSCs and the underlying sediment deep layers (DLs). Different bacterial microbiomes inhabited the BSCs and the DLs, and their composition varied among sites, indicating a niche\uffe2\uff80\uff90specific role of the micro\uffe2\uff80\uff90environmental conditions in the bacterial communities' assembly. In the heterogeneous sediments of glacier moraines, physico\uffe2\uff80\uff90chemical and micro\uffe2\uff80\uff90climatic variations at the site\uffe2\uff80\uff90spatial scale are crucial in shaping the microbiome microvariability and structuring the pioneer bacterial communities during pedogenesis.</p>", "keywords": ["0301 basic medicine", "Pedogenesis", "0303 health sciences", "Glacier Foreland Succession", "Bacteria", "Biological soil crust", "15. Life on land", "Primary Colonization", "Soil", "03 medical and health sciences", "13. Climate action", "RNA", " Ribosomal", " 16S", "Glacier Moraines", "Cold Deserts", "Pioneer Bacterial Communities", "Ice Cover", "Soil moisture", "Research Articles", "Soil Microbiology"]}, "links": [{"href": "https://air.unimi.it/bitstream/2434/949070/2/Rolli%20et%20al%202022%20Environmental%20micro%e2%80%90niche%20filtering%20shapes%20bacterial%20pioneer%20communities.pdf"}, {"href": "https://eprints.ncl.ac.uk/fulltext.aspx?url=302678/40A25368-9064-4886-B8E6-E7942511FA71.pdf&pub_id=302678"}, {"href": "https://doi.org/10.1111/1462-2920.16268"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Environmental%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/1462-2920.16268", "name": "item", "description": "10.1111/1462-2920.16268", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/1462-2920.16268"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-18T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2010.03.026", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:17:22Z", "type": "Journal Article", "created": "2010-04-14", "title": "Nitrogen Alters Carbon Dynamics During Early Succession In Boreal Forest", "description": "Boreal forests are an important source of wood products, and fertilizers could be used to improve forest yields, especially in nutrient poor regions of the boreal zone. With climate change, fire frequencies may increase, resulting in a larger fraction of the boreal landscape present in early-successional stages. Since most fertilization studies have focused on mature boreal forests, the response of burned boreal ecosystems to increased nutrient availability is unclear. Therefore, we used a nitrogen (N) fertilization experiment to test how C cycling in a recently-burned boreal ecosystem would respond to increased N availability. We hypothesized that fertilization would increase rates of decomposition, soil respiration, and the activity of extracellular enzymes involved in C cycling, thereby reducing soil C stocks. In line with our hypothesis, litter mass loss increased significantly and activities of cellulose- and chitin-degrading enzymes increased by 45\u201361% with N addition. We also observed a significant decline in C concentrations in the organic soil horizon from 19.5 \u00b1 0.7% to 13.5 \u00b1 0.6%, and there was a trend toward lower total soil C stocks in the fertilized plots. Contrary to our hypothesis, mean soil respiration over three growing seasons declined by 31% from 78.3 \u00b1 6.5 mg CO2\u2013C m\u22122 h\u22121 to 54.4 \u00b1 4.1 mg CO2\u2013C m\u22122 h\u22121. These changes occurred despite a 2.5-fold increase in aboveground net primary productivity with N, and were accompanied by significant shifts in the structure of the fungal community, which was dominated by Ascomycota. Our results show that the C cycle in early-successional boreal ecosystems is highly responsive to N addition. Fertilization results in an initial loss of soil C followed by depletion of soil C substrates and development of a distinct and active fungal community. Total microbial biomass declines and respiration rates do not keep pace with plant inputs. These patterns suggest that N fertilization could transiently reduce but then increase ecosystem C storage in boreal regions experiencing more frequent fires.", "keywords": ["0106 biological sciences", "Decomposition", "Extracellular enzyme", "Agricultural and Veterinary Sciences", "Fungi", "Agronomy & Agriculture", "Soil respiration", "04 agricultural and veterinary sciences", "Biological Sciences", "15. Life on land", "Fire", "Soil carbon", "01 natural sciences", "Nitrogen fertilization", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Boreal forest", "Succession", "Alaska", "Environmental Sciences"]}, "links": [{"href": "https://escholarship.org/content/qt4z375574/qt4z375574.pdf"}, {"href": "https://doi.org/10.1016/j.soilbio.2010.03.026"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2010.03.026", "name": "item", "description": "10.1016/j.soilbio.2010.03.026", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2010.03.026"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-07-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2010.07.011", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:17:22Z", "type": "Journal Article", "created": "2010-07-28", "title": "Resistance Of Microbial And Soil Properties To Warming Treatment Seven Years After Boreal Fire", "description": "Boreal forests store a large fraction of global terrestrial carbon and are susceptible to environmental change, particularly rising temperatures and increased fire frequency. These changes have the potential to drive positive feedbacks between climate warming and the boreal carbon cycle. Because few studies have examined the warming response of boreal ecosystems recovering from fire, we established a greenhouse warming experiment near Delta Junction, Alaska, seven years after a 1999 wildfire. We hypothesized that experimental warming would increase soil CO2 efflux, stimulate nutrient mineralization, and alter the composition and function of soil fungal communities. Although our treatment resulted in 1.20 \u00b0C soil warming, we found little support for our hypothesis. Only the activities of cellulose- and chitin-degrading enzymes increased significantly by 15% and 35%, respectively, and there were no changes in soil fungal communities. Warming resulted in drier soils, but the corresponding change in soil water potential was probably not sufficient to limit microbial activity. Rather, the warming response of this soil may be constrained by depletion of labile carbon substrates resulting from combustion and elevated soil temperatures in the years after the 1999 fire. We conclude that positive feedbacks between warming and the microbial release of soil carbon are weak in boreal ecosystems lacking permafrost. Since permafrost-free soils underlie 45\u201360% of the boreal zone, our results should be useful for modeling the warming response during recovery from fire in a large fraction of the boreal forest.", "keywords": ["0301 basic medicine", "Decomposition", "0303 health sciences", "Extracellular enzyme", "Agricultural and Veterinary Sciences", "Fungi", "Agronomy & Agriculture", "Soil respiration", "Biological Sciences", "15. Life on land", "Fire", "Soil carbon", "Climate Action", "03 medical and health sciences", "13. Climate action", "Boreal forest", "Warming", "Succession", "Alaska", "Environmental Sciences"]}, "links": [{"href": "https://escholarship.org/content/qt2zk6k6ms/qt2zk6k6ms.pdf"}, {"href": "https://doi.org/10.1016/j.soilbio.2010.07.011"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2010.07.011", "name": "item", "description": "10.1016/j.soilbio.2010.07.011", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2010.07.011"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-10-01T00:00:00Z"}}, {"id": "10.1016/j.soilbio.2014.06.021", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:17:26Z", "type": "Journal Article", "created": "2014-07-03", "title": "Disturbance-Diversity Relationships For Soil Fauna Are Explained By Faunal Community Biomass In A Salt Marsh", "description": "Disturbance-diversity relationships have long been studied in ecology with a unimodal relationship as the key prediction. Although this relationship has been widely contested, it is rarely tested for soil invertebrate fauna, an important component of terrestrial biodiversity. We tested disturbance-diversity relationships for soil meso- and macrofauna in a salt marsh where periodic sea water inundation and cattle grazing occur as stressors. We hypothesized a unimodal inundation frequency-diversity relationship, whereas we expected grazing to overrule the effects of inundation frequency due to its large effects on the habitat of soil fauna. We found a negative relationship between inundation frequency and diversity at the ungrazed sites and no relationship at the grazed sites. Moreover, we found a negative relationship between community biomass and diversity for soil fauna that may have caused this negative disturbance-diversity relationship. Community biomass at the intermediate inundation frequency increased due to the dominance of Orchestia gammarellus (a macro-detritivore species), which could exploit low quality litters at the ungrazed sites. We highlight that the negative relationship between faunal community biomass and faunal diversity may influence disturbance-diversity relationships and illustrate that total biomass distribution of feeding guilds of soil fauna can improve our understanding of the soil fauna response to stressors in salt marshes. \u00a9 2014 Elsevier Ltd.", "keywords": ["COLLEMBOLA", "DYNAMICS", "0106 biological sciences", "Salt marsh", "productivity", "Feeding guilds", "SUCCESSION", "COMPETITION", "01 natural sciences", "COEXISTENCE", "RICHNESS", "patterns", "SDG 14 - Life Below Water", "14. Life underwater", "Orchestia gammarellus", "INTERMEDIATE DISTURBANCE", "Intermediate disturbance hypothesis", "PRODUCTIVITY", "coexistence", "SPECIES-DIVERSITY", "collembola", "Soil invertebrate fauna", "dynamics", "intermediate disturbance", "15. Life on land", "succession", "species-diversity", "PATTERNS", "competition", "richness"]}, "links": [{"href": "https://doi.org/10.1016/j.soilbio.2014.06.021"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1016/j.soilbio.2014.06.021", "name": "item", "description": "10.1016/j.soilbio.2014.06.021", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1016/j.soilbio.2014.06.021"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2014-11-01T00:00:00Z"}}, {"id": "10.1111/j.1365-2486.2007.01406.x", "type": "Feature", "geometry": null, "properties": {"license": "Closed Access", "updated": "2026-07-27T16:19:34Z", "type": "Journal Article", "created": "2007-08-28", "title": "The Legacy Of Harvest And Fire On Ecosystem Carbon Storage In A North Temperate Forest", "description": "Abstract<p>Forest harvesting and wildfire were widespread in the upper Great Lakes region of North America during the early 20th century. We examined how long this legacy of disturbance constrains forest carbon (C) storage rates by quantifying C pools and fluxes after harvest and fire in a mixed deciduous forest chronosequence in northern lower Michigan, USA. Study plots ranged in age from 6 to 68 years and were created following experimental clear\uffe2\uff80\uff90cut harvesting and fire disturbance. Annual C storage was estimated biometrically from measurements of wood, leaf, fine root, and woody debris mass, mass losses to herbivory, soil C content, and soil respiration. Maximum annual C storage in stands that were disturbed by harvest and fire twice was 26% less than a reference stand receiving the same disturbance only once. The mechanism for this reduction in annual C storage was a long\uffe2\uff80\uff90lasting decrease in site quality that endured over the 62\uffe2\uff80\uff90year timeframe examined. However, during regrowth the harvested and burned forest rapidly became a net C sink, storing 0.53\uffe2\uff80\uff83Mg\uffe2\uff80\uff83C\uffe2\uff80\uff83ha\uffe2\uff88\uff921\uffe2\uff80\uff83yr\uffe2\uff88\uff921after 6 years. Maximum net ecosystem production (1.35\uffe2\uff80\uff83Mg\uffe2\uff80\uff83C\uffe2\uff80\uff83ha\uffe2\uff88\uff921\uffe2\uff80\uff83yr\uffe2\uff88\uff921) and annual C increment (0.95\uffe2\uff80\uff83Mg\uffe2\uff80\uff83C\uffe2\uff80\uff83ha\uffe2\uff88\uff921\uffe2\uff80\uff83yr\uffe2\uff88\uff921) were recorded in the 24\uffe2\uff80\uff90 and 50\uffe2\uff80\uff90year\uffe2\uff80\uff90old stands, respectively. Net primary production averaged 5.19\uffe2\uff80\uff83Mg\uffe2\uff80\uff83C\uffe2\uff80\uff83ha\uffe2\uff88\uff921\uffe2\uff80\uff83yr\uffe2\uff88\uff921in experimental stands, increasing by &lt; 10% from 6 to 50 years. Soil heterotrophic respiration was more variable across stand ages, ranging from 3.85\uffe2\uff80\uff83Mg\uffe2\uff80\uff83C\uffe2\uff80\uff83ha\uffe2\uff88\uff921\uffe2\uff80\uff83yr\uffe2\uff88\uff921in the 6\uffe2\uff80\uff90year\uffe2\uff80\uff90old stand to 4.56\uffe2\uff80\uff83Mg\uffe2\uff80\uff83C\uffe2\uff80\uff83ha\uffe2\uff88\uff921\uffe2\uff80\uff83yr\uffe2\uff88\uff921in the 68\uffe2\uff80\uff90year\uffe2\uff80\uff90old stand. These results suggest that harvesting and fire disturbances broadly distributed across the region decades ago caused changes in site quality and successional status that continue to limit forest C storage rates.</p>", "keywords": ["disturbance", "570", "aspen", "net primary production", "net ecosystem production", "carbon storage", "15. Life on land", "01 natural sciences", "logging", "630", "succession", "northern hardwoods", "Biology", "fire", "legacy effects", "0105 earth and related environmental sciences"], "contacts": [{"organization": "Katherine H. Harrold, Christoph S. Vogel, Peter S. Curtis, Christopher M. Gough, Kristen George,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1111/j.1365-2486.2007.01406.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Global%20Change%20Biology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/j.1365-2486.2007.01406.x", "name": "item", "description": "10.1111/j.1365-2486.2007.01406.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/j.1365-2486.2007.01406.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2007-07-17T00:00:00Z"}}, {"id": "10.1046/j.1365-2745.1999.00349.x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:18:35Z", "type": "Journal Article", "created": "2003-03-12", "title": "Nitrogen And Phosphorus Limitation In A Coastal Barrier Salt Marsh: The Implications For Vegetation Succession", "description": "<p>1 A factorial fertilizer experiment was conducted in a 15-year-old coastal barrier salt marsh with a low soil nitrogen content, and in an older 100-year-old marsh with a higher nitrogen content. Plots were fertilized at high and low marsh elevations in both marshes. Nitrogen and phosphorus were applied at low and high concentrations both separately and in combination in each of 3 successive years.</p><p>2 Nitrogen limited above-ground plant growth in both young and old salt marshes in all years. Phosphorus limitation of plant growth was apparent in the first year in the young marsh and in the last year in both marshes. In young marshes with low soil organic matter, phosphorus limitation may occur. In addition, phosphorus limitation occurs at both successional stages when a marsh is saturated with nitrogen.</p><p>3 Plant species that are typical of nitrogen-rich habitats and late successional stages significantly increased in biomass after fertilization. Limonium vulgare, a low stature species of early and intermediate successional stages, decreased in biomass, whereas the taller Elymus pycnanthus and Artemisia maritima increased. After 3 years of fertilization, plant species composition in a young marsh was similar to the species composition in an unfertilized older marsh. Fertilization of a 100-year-old marsh, however, still resulted in a change in plant species composition, suggesting that succession was still occurring and that, overall, plants in marshes of different age are similar in their response to fertilization.</p>", "keywords": ["0106 biological sciences", "PRODUCTIVITY", "herbivory", "plant succession", "15. Life on land", "fertilization experiment", "01 natural sciences", "nitrogen", "SOILS", "NUTRIENT LIMITATION", "PLANT-SPECIES COMPOSITION", "PROLINE", "PATTERNS", "COMMUNITIES", "plant-species interactions", "ACCUMULATION"], "contacts": [{"organization": "Jan P. Bakker, Harm van Wijnen,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1046/j.1365-2745.1999.00349.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20of%20Ecology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1046/j.1365-2745.1999.00349.x", "name": "item", "description": "10.1046/j.1365-2745.1999.00349.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1046/j.1365-2745.1999.00349.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "1999-03-01T00:00:00Z"}}, {"id": "10.1055/s-2001-17730", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:18:39Z", "type": "Journal Article", "created": "2002-07-26", "title": "The Impact Of Sheep Grazing On Net Nitrogen Mineralization Rate In Two Temperate Salt Marshes", "description": "<p>Abstract:  Nitrogen mineralization rate was studied in grazing trials with three different stocking rates (0, 3, 10 sheep ha\uffe2\uff80\uff901) in two man\uffe2\uff80\uff90made salt marshes, viz. a Puccinellia maritima\uffe2\uff80\uff90dominated low salt marsh and a high salt marsh dominated by Festuca rubra. Mineralization rates were derived from the amounts of mineral N which accumulated in situ during six\uffe2\uff80\uff90week incubation periods in tubes containing undisturbed soil cores from the upper 10 cm soil layer. The annual rates of net N mineralization were significantly higher in the better drained, high salt marsh (71 \uffe2\uff80\uff90 81 kg ha\uffe2\uff80\uff901 yr\uffe2\uff80\uff901) than in the low salt marsh (39 \uffe2\uff80\uff90 49 kg ha\uffe2\uff80\uff901 yr\uffe2\uff80\uff901). High amounts of belowground litter accumulated in the low salt marsh due to frequent water logging. Both N mineralization and nitrification rate were negatively correlated with soil water content. In the Puccinellia maritima salt marsh, grazing had neither an effect on N mineralization rates during any of the incubation periods nor on annual mineralization rates. In the Festuca rubra salt marsh, N mineralization rates increased earlier during spring at the intensively grazed site than at the moderately grazed and the ungrazed site. N mineralization and nitrification rates were significantly higher at the ungrazed site than at the intensively grazed site during the period of peak net N mineralization from the end of April until mid\uffe2\uff80\uff90June. Although sheep grazing affected the seasonal pattern of N mineralization in the high marsh, grazing did not affect the annual rate of net N mineralization.</p>", "keywords": ["2. Zero hunger", "0106 biological sciences", "LIMITATION", "seasonality", "SUCCESSION", "MICROBIAL BIOMASS", "15. Life on land", "grazing experiment", "01 natural sciences", "nitrification", "salt marsh", "zonation", "PSEUDOREPLICATION", "vegetation", "PLANT-GROWTH", "HERBIVORES", "ECOSYSTEM", "VEGETATION", "nitrogen mineralization"]}, "links": [{"href": "https://doi.org/10.1055/s-2001-17730"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Plant%20Biology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1055/s-2001-17730", "name": "item", "description": "10.1055/s-2001-17730", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1055/s-2001-17730"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2001-09-01T00:00:00Z"}}, {"id": "10.1111/j.0030-1299.2008.16333.x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:19:30Z", "type": "Journal Article", "created": "2008-03-21", "title": "Earthworms Counterbalance The Negative Effect Of Microorganisms On Plant Diversity And Enhance The Tolerance Of Grasses To Nematodes", "description": "<p>Plant community composition is affected by a wide array of soil organisms with diverse feeding modes and functions. Former studies dealt with the high diversity and complexity of soil communities by focusing on particular functional groups in isolation, by grouping soil organisms into body size classes or by using whole communities from different origins. Our approach was to investigate both the individual and the interaction effects of highly abundant soil organisms (microorganisms, nematodes and earthworms) to evaluate their impacts on grassland plant communities. Earthworms increased total plant community biomass by stimulating root growth. Nematodes reduced the biomass of grasses, but this effect was alleviated by the presence of earthworms. Non\uffe2\uff80\uff90leguminous forb biomass increased in the presence of nematodes, probably due to an alleviation of the competitive strength of grasses by nematodes. Microorganisms reduced the diversity and evenness of the plant community, but only in the absence of earthworms. Legume biomass was not affected by soil organisms, butLotus corniculatusflowered earlier in the presence of microorganisms and the number of flowers decreased in the presence of nematodes. The results indicate that earthworms have a profound impact on the structure of grassland plant communities by counterbalancing the negative effects of plant\uffe2\uff80\uff90feeding nematodes on grasses and by conserving the evenness of the plant community. We propose that interacting effects of functionally dissimilar soil organisms on plant community performance have to be taken into account in future studies, since individual effects of soil organism groups may cancel out each other in functionally diverse soil communities.</p>", "keywords": ["2. Zero hunger", "0106 biological sciences", "0301 basic medicine", "productivity", "microbial biomass", "ground insect herbivory", "early succession", "15. Life on land", "determinant", "01 natural sciences", "03 medical and health sciences", "lumbricidae", "soil food-web", "community structure", "grassland", "performance"]}, "links": [{"href": "https://doi.org/10.1111/j.0030-1299.2008.16333.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Oikos", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/j.0030-1299.2008.16333.x", "name": "item", "description": "10.1111/j.0030-1299.2008.16333.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/j.0030-1299.2008.16333.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2008-04-28T00:00:00Z"}}, {"id": "10.5061/dryad.ht76hdrnm", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:22:30Z", "type": "Dataset", "created": "2023-10-19", "title": "Data from: Abiotic legacies mediate plant-soil feedback during early vegetation succession on rare earth element mine tailings", "description": "Open AccessAn increasing number of studies have shown how feedback interactions  between plants and soil can influence primary and secondary succession.  However, very little is known about the patterns and mechanisms of such  plant-soil feedbacks on stressed mine tailings ecosystem, which can be  severely contaminated by a range of toxic elements.\u00a0 In a  two-phase plant-soil feedback experiment based on the rare earth element  (REE) mine tailing soil, we investigated biotic (changes in bacterial and  fungal community) and abiotic legacies (changes in chemical properties) of  three pioneer grass species, and examined feedback effects of three  grasses, two legumes and two woody plants with different root traits.  Positive plant-soil feedback was found in Miscanthus sinensis, Paspalum  thunbergii and Tephrosia candida, and neutral feedback was observed in  other four plants. These effects corresponded with an increase of  nutrients and total organic carbon, as well as a decrease of acidity and  extractable aluminum and REEs. There were less signs of biotic changes in  the conditioned tailings.\u00a0 The correlation analysis suggested a  relationship between responses to soil legacies and root traits, as well  as root economics spectrum. On the mine tailings, acquisitive species with  higher specific root length appeared to have greater potential for  positive feedback.\u00a0 Synthesis and application: Our study shows  that early succession on contaminated REE mine tailings may lead to more  positive plant-soil feedback than predicted based on results of  non-contaminated soils, mainly due to the alleviation of abiotic stress in  tailings. Therefore, the improvement of specific abiotic soil stress and  the trait-based selection of acquisitive plants should be preferentially  considered to promote the primary restoration of degraded land.", "keywords": ["plant-soil feedback", "primary succession", "rare earth mine waste soil", "Trait-based approach", "root functional traits", "FOS: Earth and related environmental sciences", "soil legacies", "Ecological restoration"], "contacts": [{"organization": "Zhu, Shi Chen, Liu, Wen Shen, Chen, Zi Wu, Liu, Xiao Rui, Zheng, Hong Xiang, Chen, Bo Yu, Zhi, Xin Yu, Chao, Yuanqing, Qiu, Rong Liang, Chu, Chengjin, Liu, Chong, Morel, Jean Louis, van der Ent, Antony, Tang, Ye Tao,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.ht76hdrnm"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.ht76hdrnm", "name": "item", "description": "10.5061/dryad.ht76hdrnm", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.ht76hdrnm"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-01-01T00:00:00Z"}}, {"id": "10.1111/ecog.05478", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:19:21Z", "type": "Journal Article", "created": "2021-05-07", "title": "Multi\u2010taxa colonisation along the foreland of a vanishing equatorial glacier", "description": "<p>Retreating glaciers, icons of climate change, release new potential habitats for both aquatic and terrestrial organisms. High\uffe2\uff80\uff90elevation species are threatened by temperature increases and the upward migration of lowlands species. Improving our understanding of successional processes after glacier retreat becomes urgent, especially in the tropics, where glacier shrinkage is particularly fast. We examined the successional patterns of aquatic invertebrates, ground beetles, terrestrial plants, soil eukaryotes (algae, invertebrates, plants) in an equatorial glacier foreland (Carihuairazo, Ecuador). Based on both taxonomical identification and eDNA metabarcoding, we analysed the effects of both environmental conditions and age of deglacierization on community composition. Except for algae, diversity increased with time since deglacierization, especially among passive dispersers, suggesting that dispersal was a key driver structuring the glacier foreland succession. Spatial \uffce\uffb2\uffe2\uff80\uff90diversity was mainly attributed to nestedness for aquatic invertebrates, terrestrial plants and soil algae, likely linked to low environmental variability within the studied glacier foreland; and to turnover for soil invertebrates, suggesting competition exclusion at the oldest successional stage. Pioneer communities were dominated by species exhibiting flexible feeding strategies and high dispersal ability (mainly transported by wind), probably colonising from lower altitudes, or from the glacier in the case of algae. Overall, glacier foreland colonisation in the tropics exhibit common characteristics to higher latitudes. High\uffe2\uff80\uff90elevation species are nevertheless threatened, as the imminent extinction of many tropical glaciers will affect species associated to glacier\uffe2\uff80\uff90influenced habitats but also prevent cold\uffe2\uff80\uff90adapted and hygrophilous species from using these habitats as refuges in a warming world.</p>", "keywords": ["Colonization", "[SDV.BID.SPT]Life Sciences [q-bio]/Biodiversity/Systematics", "550", "Early succession", "glacier retreat", "Sociology", "[SDV.EE.ECO] Life Sciences [q-bio]/Ecology", " environment/Ecosystems", "Environmental DNA Sequencing", "Glacier", "Ecology", "Geography", "early succession", "Life Sciences", "Phylogenetics and taxonomy", "Biodiversity", "[SDV.BV.BOT]Life Sciences [q-bio]/Vegetal Biology/Botanics", "Threatened species", "FOS: Sociology", "Multiple-taxa", "multiple-taxa", "Habitat", "[SDE]Environmental Sciences", "Physical Sciences", "environment/Ecosystems", "570", "Physical geography", "Population", "Global Diversity of Microbial Eukaryotes and Their Evolution", "[SDV.BV.BOT] Life Sciences [q-bio]/Vegetal Biology/Botanics", "Ecological succession", "Biochemistry", " Genetics and Molecular Biology", "Biological dispersal", "[SDV.BID.SPT] Life Sciences [q-bio]/Biodiversity/Systematics", " Phylogenetics and taxonomy", "equatorial glacier foreland", "Equatorial glacier foreland", "Glacier retreat", "Molecular Biology", "Biology", "Demography", "Marine Microbial Diversity and Biogeography", "Colonisation", "South America", "15. Life on land", "[SDE.BE] Environmental Sciences/Biodiversity and Ecology", "13. Climate action", "FOS: Biological sciences", "[SDV.EE.ECO]Life Sciences [q-bio]/Ecology", "Environmental Science", "[SDE.BE]Environmental Sciences/Biodiversity and Ecology", "early succession; equatorial glacier foreland; glacier retreat; multiple-taxa", "Environmental DNA in Biodiversity Monitoring"]}, "links": [{"href": "https://air.unimi.it/bitstream/2434/851699/2/rosero%202021.pdf"}, {"href": "https://onlinelibrary.wiley.com/doi/pdf/10.1111/ecog.05478"}, {"href": "https://doi.org/10.1111/ecog.05478"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecography", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/ecog.05478", "name": "item", "description": "10.1111/ecog.05478", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/ecog.05478"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-05-06T00:00:00Z"}}, {"id": "10.3390/plants12051162", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:21:56Z", "type": "Journal Article", "created": "2023-03-06", "title": "Spontaneous Primary Succession and Vascular Plant Recovery in the Iberian Gypsum Quarries: Insights for Ecological Restoration in an EU Priority Habitat", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Gypsum covers a vast area of the Iberian Peninsula, making Spain a leader in its production. Gypsum is a fundamental raw material for modern societies. However, gypsum quarries have an obvious impact on the landscape and biodiversity. Gypsum outcrops host a high percentage of endemic plants and unique vegetation, considered a priority by the EU. Restoring gypsum areas after mining is a key strategy to prevent biodiversity loss. For the implementation of restoration approaches, understanding vegetation\u2019s successional processes can be of invaluable help. To fully document the spontaneous succession in gypsum quarries and to evaluate its interest for restoration, 10 permanent plots of 20 \u00d7 50 m were proposed, with nested subplots, in which vegetation change was recorded for 13 years in Almeria (Spain). Through Species-Area Relationships (SARs), these plots\u2019 floristic changes were monitored and compared to others in which an active restoration was carried out, as well as others with natural vegetation. Furthermore, the successional pattern found was compared to those recorded in 28 quarries distributed throughout the Spanish territory. The results show that an ecological pattern of spontaneous primary auto-succession is widely recurring in Iberian gypsum quarries, which is capable of regenerating the pre-existing natural vegetation.</p></article>", "keywords": ["QK1-989", "Botany", "gypsum mining", "permanent plots", "passive restoration", "15. Life on land", "Species-Area Relationships (SAR)", "gypsophil", "successional chronosequence", "Article"]}, "links": [{"href": "http://www.mdpi.com/2223-7747/12/5/1162/pdf"}, {"href": "https://www.mdpi.com/2223-7747/12/5/1162/pdf"}, {"href": "https://doi.org/10.3390/plants12051162"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Plants", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3390/plants12051162", "name": "item", "description": "10.3390/plants12051162", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3390/plants12051162"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-03-03T00:00:00Z"}}, {"id": "10.1111/j.1461-0248.2009.01352.x", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:19:40Z", "type": "Journal Article", "created": "2009-07-23", "title": "Shrub Encroachment Can Reverse Desertification In Semi-Arid Mediterranean Grasslands", "description": "Abstract<p>The worldwide phenomenon of shrub encroachment in grass\uffe2\uff80\uff90dominated dryland ecosystems is commonly associated with desertification. Studies of the purported desertification effects associated with shrub encroachment are often restricted to relatively few study areas, and document a narrow range of possible impacts upon biota and ecosystem processes. We conducted a study in degraded Mediterranean grasslands dominated by Stipa tenacissima to simultaneously evaluate the effects of shrub encroachment on the structure and composition of multiple biotic community components, and on various indicators of ecosystem function. Shrub encroachment enhanced vascular plant richness, biomass of fungi, actinomycetes and other bacteria, and was linked with greater soil fertility and N mineralization rates. While shrub encroachment may be a widespread phenomenon in drylands, an interpretation that this is an expression of desertification is not universal. Our results suggest that shrub establishment may be an important step in the reversal of desertification processes in the Mediterranean region.</p>", "keywords": ["0106 biological sciences", "2. Zero hunger", "Mediterranean Region", "Shrub encroachment", "Mediterranean", "15. Life on land", "01 natural sciences", "Soil", "Stipa tenacissima", "Semi-arid", "13. Climate action", "Ecosystem functioning", "Desert Climate", "Plant successional dynamics", "Global change", "Desertification", "Ecosystem", "Plant Physiological Phenomena"]}, "links": [{"href": "https://doi.org/10.1111/j.1461-0248.2009.01352.x"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecology%20Letters", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/j.1461-0248.2009.01352.x", "name": "item", "description": "10.1111/j.1461-0248.2009.01352.x", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/j.1461-0248.2009.01352.x"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2009-08-13T00:00:00Z"}}, {"id": "10.1111/jvs.12317", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:19:47Z", "type": "Journal Article", "created": "2015-06-24", "title": "Large Herbivores Change The Direction Of Interactions Within Plant Communities Along A Salt Marsh Stress Gradient", "description": "AbstractQuestion<p>How multiple abiotic stress factors combined with herbivory affect interactions within plant communities is poorly understood. We ask how large herbivore grazing affects the direction of plant\uffe2\uff80\uff93plant interactions along an environmental gradient in a salt marsh.</p>Location<p>Grazed (cattle) and ungrazed salt marshes of the Dutch Wadden Sea island Schiermonnikoog. Here, patches of tall plant communities, dominated by the tough, unpalatable species Juncus maritimus Lam., are found alternating with low\uffe2\uff80\uff90statured, intensively grazed plant communities.</p>Methods<p>Along the inundation gradient, we measured plant species composition and plant species traits (specific leaf area, specific root length, maximum height and abundance) inside and outside J.\uffc2\uffa0maritimus patches in grazed and ungrazed areas. In addition, we measured soil structure parameters (bulk density, soil porosity, clay depth), multiple limiting conditions for plant growth (soil salinity, soil redox, plant canopy light interception), plant biomass, presence of herbivores and abundance of soil macro\uffe2\uff80\uff90detritivores.</p>Results<p>Under grazing, the palatable grasses Elytrigia atherica (Link) Kergu\uffc3\uffa9len and Festuca rubra L. were positively associated with J.\uffc2\uffa0maritimus, while shade\uffe2\uff80\uff90intolerant Puccinellia maritima (Huds.) Parl. and Juncus gerardii\uffc2\uffa0 Loisel. were negatively associated with this species. Furthermore, macro\uffe2\uff80\uff90detritivore presence was higher inside J.\uffc2\uffa0maritimus patches. In ungrazed areas E.\uffc2\uffa0atherica and F.\uffc2\uffa0rubra were negatively associated with J.\uffc2\uffa0maritimus, while P.\uffc2\uffa0maritima and J.\uffc2\uffa0gerardii were rare. In both grazed and ungrazed conditions the directions of species associations were independent of the inundation gradient. Analysis of species traits and abiotic conditions suggested that associational resistance (a facilitation type) was important in grazed areas. In ungrazed areas, light competition was the likely dominant process.</p>Conclusions<p>The direction of species associations within these salt marsh communities was strongly affected by grazing, not by the underlying stress gradient. Measurement of species traits indicated that plant\uffe2\uff80\uff93plant interactions shifted from competitive to facilitative under grazing. Besides grazing, cross\uffe2\uff80\uff90trophic facilitation of soil disturbing macro\uffe2\uff80\uff90detritivores may play an important \uffe2\uff80\uff93 thus far ignored \uffe2\uff80\uff93 role in structuring plant communities.</p>", "keywords": ["Plant traits", "2. Zero hunger", "0106 biological sciences", "Salt marsh", "Macro-detritivores", "SUCCESSION", "Stress gradient hypothesis", "PREDICTIONS", "COMPETITION", "HALOPHYTES", "15. Life on land", "ALKALI GRASSLANDS", "FACILITATION", "01 natural sciences", "POSITIVE SPECIES INTERACTIONS", "Grazing", "Plant-plant interactions", "FUNCTIONAL TRAITS", "Trampling", "Orchestia gammarellus Pallas. 1766", "BIOTURBATION", "Facilitation", "Juncus maritimus Lam.", "VEGETATION", "Multiple stressors"]}, "links": [{"href": "https://doi.org/10.1111/jvs.12317"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20of%20Vegetation%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1111/jvs.12317", "name": "item", "description": "10.1111/jvs.12317", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1111/jvs.12317"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2015-06-24T00:00:00Z"}}, {"id": "10.1139/x92-146", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:19:59Z", "type": "Journal Article", "created": "2009-12-18", "title": "Carbon Storage In Lake States Aspen Ecosystems", "description": "<p> Total ecosystem carbon in the soil and vegetation was measured for a range of aspen (Populustremuloides Michx.) ecosystems, including a chronosequence on the same soil ranging in age from 0 to 80 years. Soil carbon stayed relatively constant throughout the stand's life and was not affected by timber harvesting. Changes in ecosystem carbon closely paralleled the changes in standing biomass. Aspen grown on 40-year rotations on good soils will sequester several times as much carbon per year as old-growth forests. </p>", "keywords": ["Management Options", "0106 biological sciences", "Michigan", "Spermatophyta", "Angiosperms", "Broadleaves", "wisconsin", "aspen", "Minnesota", "01 natural sciences", "Dicots", "forest succession", "Spermatophytes", "Populus tremuloides", "Biomass", "Plantae", "Forest Sciences", "USA", "Vascular Plants", "Salicaceae: Dicotyledones", "carbon", "Rotation Length", "age of trees", "Forestry", "Carbon cycle", "plant succession", "Plants", "Timber Harvest", "forest ecosystem", "carbon storage", "15. Life on land", "Angiospermae", "Chronosequence Soil Carbon", "ecosystems"], "contacts": [{"organization": "Alban, David H., Perala, D.A.,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1139/x92-146"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Canadian%20Journal%20of%20Forest%20Research", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1139/x92-146", "name": "item", "description": "10.1139/x92-146", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1139/x92-146"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "1992-08-01T00:00:00Z"}}, {"id": "10.1590/s0100-06832010000100022", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:20:31Z", "type": "Journal Article", "created": "2010-04-29", "title": "Physical Properties Of A Humic Cambisol Under Tillage And Cropping Systems After 12 Years", "description": "<p>Soil is the basis underlying the food production chain and it is fundamental to improve and conserve its productive capacity. Imbalanced exploitation can degrade agricultural areas physical, chemical and biologically. The objective of this study was to evaluate some soil physical properties and their relation with organic carbon contents of a Humic Dystrudept under conventional tillage (CT) and no-tillage (NT), for 12 years in rotation (r) and succession (s) cropping systems. The experiment was carried out in Lages, SC (latitude 27 \uffc2\uffba 49 ' S and longitude 50 \uffc2\uffba 20 ' W, 937 m asl), using crop sequences of bean-fallow-maize-fallow-soybean in conventional tillage rotation; maize-fallow in conventional tillage succession; bean-oat-maize-turnip-soybean-vetch in no-tillage rotation; and maize-vetch in no-tillage succession. The experimental design was completely randomized with four replications. The soil samples were collected in the layers 0-2.5, 2.5-5, 5-10, and 10-20 cm. The following properties were analyzed: soil density, porosity, aggregate stability, degree of flocculation, water retention, infiltration, mechanical strength, and total organic carbon. Soil aggregation in the surface layer (0-5 cm) was better in the no-tillage than the conventional system, related to higher microporosity, organic carbon contents and water retention capacity, indicating that a periodical tillage of this soil is unnecessary. Infiltration was highest in no-tillage with crop succession.</p>", "keywords": ["2. Zero hunger", "0106 biological sciences", "no-tillage", "04 agricultural and veterinary sciences", "15. Life on land", "01 natural sciences", "6. Clean water", "manejo do solo", "semeadura direta", "rota\u00e7\u00e3o de culturas", "crop rotation", "sucess\u00e3o de culturas", "0401 agriculture", " forestry", " and fisheries", "soil management", "crop succession"], "contacts": [{"organization": "Andr\u00e9ia Patr\u00edcia Andrade, I. Bertol, I. Bertol, \u00c1lvaro Luiz Mafra, \u00c1lvaro Luiz Mafra, Jackson Adriano Albuquerque, Jackson Adriano Albuquerque, Cristiano Dela Piccolla, Gizele Rejane Baldo,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.1590/s0100-06832010000100022"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Revista%20Brasileira%20de%20Ci%C3%AAncia%20do%20Solo", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1590/s0100-06832010000100022", "name": "item", "description": "10.1590/s0100-06832010000100022", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1590/s0100-06832010000100022"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-02-01T00:00:00Z"}}, {"id": "10.1890/03-5133", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:20:42Z", "type": "Journal Article", "created": "2007-06-06", "title": "Relationships Among Fires, Fungi, And Soil Dynamics In Alaskan Boreal Forests", "description": "Fires are critical pathways of carbon loss from boreal forest soils, whereas microbial communities form equally critical controls over carbon accumulation between fires. We used a chronosequence in Alaska to test Read's hypothesis that arbuscular my- corrhizal fungi should dominate ecosystems with low accumulation of surface litter, and ectomycorrhizal fungi should proliferate where organic horizons are well-developed. This pattern is expected because ectomycorrhizal fungi display a greater capacity to mineralize organic compounds than do arbuscular mycorrhizal fungi. The sites were located in upland forests near Delta Junction, Alaska, and represent stages at 3, 15, 45, and 80 years following fire. Soil organic matter accumulated 2.8-fold over time. Fire did not noticeably reduce the abundance of arbuscular mycorrhizal fungi. In contrast, ectomycorrhizal colonization re- quired up to 15 years to return to pre-fire levels. As a result, dominant mycorrhizal groups shifted from arbuscular to ectomycorrhizal fungi as succession progressed. Bacterial func- tional diversity was greatest in the oldest sites. Altogether, microbes that can mineralize organic compounds (i.e., ectomycorrhizae and bacteria) recovered more slowly than those that cannot (i.e., arbuscular mycorrhizae). Potential net N mineralization and standing pools of ammonium-N were relatively low in the youngest site. In addition, glomalin stocks were positively correlated with arbuscular mycorrhizal hyphal length, peaking early in the chron- osequence. Our results indicate that microbial succession may influence soil carbon and nitrogen dynamics in the first several years following fire, by augmenting carbon storage in glomalin while inhibiting mineralization of organic compounds.", "keywords": ["external hyphae", "soil carbon and nitrogen", "biolog", "04 agricultural and veterinary sciences", "15. Life on land", "chronosequence", "fire and soil microbes", "succession", "Alaskan boreal forest", "mycorrhizal fungi", "organic material", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "mineralization", "microbial community", "glomalin"]}, "links": [{"href": "https://escholarship.org/content/qt3wc775gm/qt3wc775gm.pdf"}, {"href": "https://doi.org/10.1890/03-5133"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecological%20Applications", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.1890/03-5133", "name": "item", "description": "10.1890/03-5133", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.1890/03-5133"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2004-12-01T00:00:00Z"}}, {"id": "10.5061/dryad.5hk04", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:22:24Z", "type": "Dataset", "title": "Data from: Beyond plant-soil feedbacks: mechanisms driving plant community shifts due to land-use legacies in post-agricultural forests", "description": "unspecifiedData_Functional_Ecology_All_data_de_la_Pena_et_al_2016Each sheet contains  a different data set: Sheet 1: Abiotic fators Data for abiotic soil  factors i.e. pH-KCl, total nitrogen, percentage of ash rest, K, Mg, Ca,  Al, P, Olsen-P, N/P ratio, percentage of organic matter OM, percentage of  carbon, C/N ratio of soil samples collected at three forest sites in  Flanders (Belgium): Aelmoeseneie, Doode Bemde and Muizen forest. In all  sites, we compared soil conditions in ancient and postagricultural forest  parcels. Sheet 2: Nematode community Nematode composition in soil samples  collected in three different forest sites in Flanders (Belgium); at each  site ancient parcels and post-agricultural parcels were sampled. Sheet 3:  Data info of characteristics of species in the introduction experiment  Data on basic plant traits of plants reintroduced in post-agricultural and  ancient parcels in the Muizen forest (Belgium). For each plant we  meassured: length in cm, number of stems, number of holes in leaves,  number of leaves, number of leaves with signs of herbivory, proportion of  leaves showing herbivory marks, herbivory index. Sheet 4: Invertebrate  abundance on surveyed plants along transects in the Muizen forest, Belgium  Invertebrate abundance was assessed for all plants present along 10m x 1m  transects in the Muizen forest in Belgium. We compared invertebrate  abundance in post-agricultural forest parcels and ancient parcels. Sheet  5: Vegetation plots Data on vegetation plots. Plots 10 x 10m. For each  forest site i.e. Muizen forest, Aelmoeseneie(ALM) and Doode Bemde six  parcels were sampled; 3 on ancient forest parcels and 3 on  postagricultural. For each plot the understory vegetation was recorded.  Sheet 6: Vegetation transects Comparison of plant species in the  understory along transects in the Muizen forest. 10 transect surveys were  conducted in ancient forest plots and 10 in post-agricultural. Sheet 7:  Ecoplates For the characterization of the soil microbial community we used  a method that measures by spectrometric quantification the utilization by  microbes of different carbon substrates in microtiter plates (EcoPlates\u00ae).  Here we compare mean values for soil samples taken in post-agricultural  and ancient forest sites. \u2003 Sheet 8: Data experiment Urtica dioica Data on  plant traits and analysis of population build-up of Aphis urticata on  Urtica dioica plants growing in soil collected in post-agricultural forest  parcels or in ancient forest parcels. The experiment also compared the  effect of soil sterilization and provenance on plant performance by  measuring plant growth (biomass, no. of runners and flowering). Sheet 9:  Plant nutrient analysis Data on nitrogen and phosphorus content of  harvested plants from a re-introduction experiment in ancient and  post-agricultural forest parcels (in the Muizen forest, Belgium). There  were four species compared i.e. Geum urbanum, Circaea lutetiana, Primula  elatior and Urtica dioica. Plants were weighed after drying to constant  weight at 70 \u00b0C for 48 h. Sheet 10: Data Deschampsia cespitosa experiment  Data on the effect of soil sterilization (sterilized vs. non- sterile) and  provenance (i.e. ancient and post-agricultural) on plant growth of  Deschampsia cespitosa. Sheet 12 and Sheet 13: Population build-up of  aphids on Urtica dioica and Deschampsia cespitosa", "keywords": ["2. Zero hunger", "13. Climate action", "Primula elatior", "aboveground-belowground", "Geum urbanum", "Urtica dioica", "Phosphorus", "15. Life on land", "secondary succession", "diversity loss", "Deschampsia cespitosa", "Ciercaea lutetiana", "woodlands"], "contacts": [{"organization": "de la Pe\u00f1a, Eduardo, Baeten, Lander, Steel, Hanne, Viaene, Nicole, De Sutter, Nancy, De Schrijver, An, Verheyen, Kris,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.5hk04"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.5hk04", "name": "item", "description": "10.5061/dryad.5hk04", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.5hk04"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2017-04-12T00:00:00Z"}}, {"id": "10.3354/meps11447", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:21:32Z", "type": "Journal Article", "created": "2015-08-06", "title": "Ecosystem Engineering By Large Grazers Enhances Carbon Stocks In A Tidal Salt Marsh", "description": "<p>Grazers can have a large impact on ecosystem processes and are known to change vegetation composition. However, knowledge of how the long-term presence of grazers affects soil carbon sequestration is limited. In this study, we estimated total accumulated organic carbon in soils of a back-barrier salt marsh and determined how this is affected by long-term grazing by both small and large grazers in relation to age of the ecosystem. In young marshes, where small grazers predominate, hare and geese have a limited effect on total accumulated organic carbon. In older, mature marshes, where large grazers predominate, cattle substantially enhanced carbon content in the marsh soil. We ascribe this to a shift in biomass distribution in the local vegetation towards the roots in combination with trampling effects on the soil chemistry. These large grazers thus act as ecosystem engineers: their known effect on soil compaction (based on a previous study) enhances anoxic conditions in the marsh soil, thereby reducing the oxygen available for organic carbon decomposition by the local microbial community. This study showed that the indirect effects of grazing can significantly enhance soil carbon storage through changing soil abiotic conditions. This process should be taken into account when estimating the role of ecosystems in reducing carbon dioxide concentration in the atmosphere. Ultimately, we propose a testable conceptual framework that includes 3 pathways by which grazers can alter carbon storage: (1) through above-ground biomass removal, (2) through alteration of biomass distribution towards the roots and/or (3) by changing soil abiotic conditions that affect decomposition.</p>", "keywords": ["Carbon sequestration", "0106 biological sciences", "IMPACT", "SEA-LEVEL RISE", "01 natural sciences", "Coastal wetland", "Climate change", "Biology", "Soil compaction", "Succession", "VEGETATION SUCCESSION", "0105 earth and related environmental sciences", "2. Zero hunger", "CLIMATE-CHANGE", "WETLAND SOILS", "WADDEN SEA", "15. Life on land", "PRODUCTIVITY GRADIENT", "6. Clean water", "Chemistry", "Grazing", "ORGANIC-MATTER", "NORTH-SEA", "REDOX OSCILLATION", "13. Climate action", "Redox potential"]}, "links": [{"href": "https://doi.org/10.3354/meps11447"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Marine%20Ecology%20Progress%20Series", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3354/meps11447", "name": "item", "description": "10.3354/meps11447", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3354/meps11447"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2015-10-14T00:00:00Z"}}, {"id": "10.3389/fmicb.2021.676251", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:21:37Z", "type": "Journal Article", "created": "2021-06-07", "title": "Dynamics of Soil Bacterial and Fungal Communities During the Secondary Succession Following Swidden Agriculture IN Lowland Forests", "description": "<p>Elucidating dynamics of soil microbial communities after disturbance is crucial for understanding ecosystem restoration and sustainability. However, despite the widespread practice of swidden agriculture in tropical forests, knowledge about microbial community succession in this system is limited. Here, amplicon sequencing was used to investigate effects of soil ages (spanning at least 60 years) after disturbance, geographic distance (from 0.1 to 10 km) and edaphic property gradients (soil pH, conductivity, C, N, P, Ca, Mg, and K), on soil bacterial and fungal communities along a chronosequence of sites representing the spontaneous succession following swidden agriculture in lowland forests in Papua New Guinea. During succession, bacterial communities (OTU level) as well as its abundant (OTU with relative abundance &amp;gt; 0.5%) and rare (&amp;lt;0.05%) subcommunities, showed less variation but more stage-dependent patterns than those of fungi. Fungal community dynamics were significantly associated only with geographic distance, whereas bacterial community dynamics were significantly associated with edaphic factors and geographic distance. During succession, more OTUs were consistently abundant (n = 12) or rare (n = 653) for bacteria than fungi (abundant = 6, rare = 5), indicating bacteria were more tolerant than fungi to environmental gradients. Rare taxa showed higher successional dynamics than abundant taxa, and rare bacteria (mainly from Actinobacteria, Proteobacteria, Acidobacteria, and Verrucomicrobia) largely accounted for bacterial community development and niche differentiation during succession.</p", "keywords": ["tropical forests", "0301 basic medicine", "0303 health sciences", "03 medical and health sciences", "soil microbiome", "11. Sustainability", "ecological succession", "15. Life on land", "rare bacteria and fungi", "Microbiology", "slash-and-burn", "QR1-502"]}, "links": [{"href": "https://doi.org/10.3389/fmicb.2021.676251"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/fmicb.2021.676251", "name": "item", "description": "10.3389/fmicb.2021.676251", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/fmicb.2021.676251"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-07T00:00:00Z"}}, {"id": "10.3389/fmicb.2023.1158130", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:21:37Z", "type": "Journal Article", "created": "2023-04-21", "title": "Field scale biodegradation of total petroleum hydrocarbons and soil restoration by Ecopiles: microbiological analysis of the process", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Ecopiling is a method for biodegradation of hydrocarbons in soils. It derives from Biopiles, but phytoremediation is added to biostimulation with nitrogen fertilization and bioaugmentation with local bacteria. We have constructed seven Ecopiles with soil heavily polluted with hydrocarbons in Carlow (Ireland). The aim of the study was to analyze changes in the microbial community during ecopiling. In the course of 18\u2009months of remediation, total petroleum hydrocarbons values decreased in 99 and 88% on average for aliphatics and aromatics, respectively, indicating a successful biodegradation. Community analysis showed that bacterial alfa diversity (Shannon Index), increased with the degradation of hydrocarbons, starting at an average value of 7.59 and ending at an average value of 9.38. Beta-diversity analysis, was performed using Bray-Curtis distances and PCoA ordination, where the two first principal components (PCs) explain the 17 and 14% of the observed variance, respectively. The results show that samples tend to cluster by sampling time instead of by Ecopile. This pattern is supported by the hierarchical clustering analysis, where most samples from the same timepoint clustered together. We used DSeq2 to determine the differential abundance of bacterial populations in Ecopiles at the beginning and the end of the treatment. While TPHs degraders are more abundant at the start of the experiment, these populations are substituted by bacterial populations typical of clean soils by the end of the biodegradation process. Similar results are found for the fungal community, indicating that the microbial community follows a succession along the process. This succession starts with a TPH degraders or tolerant enriched community, and finish with a microbial community typical of clean soils.</p></article>", "keywords": ["hydrocarbon", "bioremediation", "microbial succession", "microbiota", "Ecopile", " hydrocarbon", " bioremediation", " microbial succession", " microbiota", "Ecopile", "15. Life on land", "Biolog\u00eda y Biomedicina / Biolog\u00eda", "Microbiology", "6. Clean water", "QR1-502"]}, "links": [{"href": "https://doi.org/10.3389/fmicb.2023.1158130"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3389/fmicb.2023.1158130", "name": "item", "description": "10.3389/fmicb.2023.1158130", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3389/fmicb.2023.1158130"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-04-21T00:00:00Z"}}, {"id": "10.5061/dryad.66t1g1k7n", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:22:25Z", "type": "Dataset", "created": "2023-12-05", "title": "Biotic and abiotic properties of biocrus", "description": "unspecifiedEukaryotic algae, as the primary group of photosynthetic autotrophs, exert  a significant influence on the development and functions of biological  crusts in dryland ecosystems. Despite their importance, there are  substantial knowledge gaps on the composition of eukaryotic algal  communities and their effects on the distributions of bacteria and fungi  in dryland soils. This study examined the eukaryotic algal community along  a successional sequence of biocrusts in the Gurbantunggut desert, while  also investigating their patterns of co-occurrence with bacteria and fungi  through high-throughput sequencing and bioinformatic analyses. The results  showed that nitrogen and phosphorus levels played a crucial role in the  regulation of changes in the abundance and composition of the algal  community. In particular, changes in the structure of the algal community  arise primarily from fluctuations in the main species, rather than from  loss and appearance of species during the biocrust succession. The  accumulation of nitrogen and phosphorus in the biocrust led to increases  in the relative abundance of algal species in the Chlorophyta. The results  also indicated that eukaryotic algae played an important role in affecting  bacterial and fungal communities and significantly improved the stability  of the microbial community, reflected by the robustness of co-occurrence  networks. The network analysis further indicated that eukaryotic algae  affected the stability of microbial co-occurrence networks either by  acting as keystone taxa or associating with the keystone bacterial and  fungal taxa. These findings reveal a clear mechanism by which soil  nitrogen and phosphorus levels affected the composition of eukaryotic  algae communities and further regulated bacterial and fungal communities  during biocrust development, providing valuable information on the  development and functional execution of biocrusts in dryland ecosystems.", "keywords": ["2. Zero hunger", "Microbial ecology", "Succession of biocrusts", "13. Climate action", "Physicochemical properties", "15. Life on land", "FOS: Natural sciences"], "contacts": [{"organization": "Zhao, Kang", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.66t1g1k7n"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.66t1g1k7n", "name": "item", "description": "10.5061/dryad.66t1g1k7n", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.66t1g1k7n"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-12-12T00:00:00Z"}}, {"id": "10.5061/dryad.6h5v2pv", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:22:25Z", "type": "Dataset", "title": "Data from: Long-term recovery of the functional community assembly and carbon pools in an African tropical forest succession", "description": "unspecifiedSupplementary  InformationRaw data underlying the  analyses in the publication.", "keywords": ["carbon stocks", "Congo Basin", "Central Africa", "carbon stocks.", "functional assembly", "15. Life on land", "secondary succession", "long-term recovery"], "contacts": [{"organization": "Bauters, Marijn, Vercleyen, Oscar, Vanlauwe, Bernard, Six, Johan, Bonyoma, Bernard, Badjoko, Henri, Hubau, Wannes, Hoyt, Alison, Boudin, Mathieu, Verbeeck, Hans, Boeckx., Pascal,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.6h5v2pv"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.6h5v2pv", "name": "item", "description": "10.5061/dryad.6h5v2pv", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.6h5v2pv"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-04-05T00:00:00Z"}}, {"id": "10.3832/ifor3682-014", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:22:10Z", "type": "Journal Article", "created": "2021-12-01", "title": "Historical fire ecology and its effect on vegetation dynamics of the Lagunas de Montebello National Park, Chiapas, M\u00e9xico", "description": "Historical information on wildfires and dendrochronological studies offer meaningful clues about fire and climate regimes, factors that affect forest structure and dynamics. This study aimed to determine the effect of fire history on vegetation dynamics and successional pathways of areas under different fire management policies in the Lagunas de Montebello National Park (LMNP), Chiapas, M\u00e9xico. The selected study sites were El Parque area under fire exclusion policies since 1961; Tziscao-inhabited area under fire prohibition since 1984; and Antel\u00e1 area with a traditional agricultural fire management history. A Pinus oocarpa ring-width chronology was used as a proxy for climate variability to which wildfire occurrence was mapped and to determine the establishment patterns of this dominant species. Current vegetation composition and structure and fuel loads were determined to characterise the study sites. Large wildfires, like those occurring in 1984 and 1998, were associated with periods of high humidity followed by intense droughts; they were linked to strong El Ni\u00f1o events and severely impacted the LMNP. Vegetation dynamics indicated simplification of mesophyll forest (climax) to pine-oak-sweetgum forests, with Pinus dominating the overstorey in all sampling sites. Pine, oak and sweetgum species were the dominant juvenile trees in Antel\u00e1, El Parque and Tziscao, respectively. Late-successional seedlings (i.e., Prunus) were present in Antel\u00e1 and El Parque, while were absent from Tziscao where several wildfires had occurred. Fuel accumulation in sites within protected areas subject to fire exclusion policies was very high (40-68 t ha-1); in contrast, it was the lowest in rural Antel\u00e1 (24 t ha-1). Considering vegetation vulnerability to wildfires associated with extreme humid-dry climate events, increased fire hazard due to fuel accumulation, and the socio-ecological impacts of these events, we recommend revising the fire exclusion policies currently implemented in the LMNP and applying an integrated fire management approach that incorporates local socio-ecological conditions.", "keywords": ["Fuel Loads", "Dendrochronology", "Ecological Succession", "Forestry", "04 agricultural and veterinary sciences", "SD1-669.5", "15. Life on land", "01 natural sciences", "Historical Ecology", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Fire Ecology", "10. No inequality", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/10.3832/ifor3682-014"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/iForest%20-%20Biogeosciences%20and%20Forestry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10.3832/ifor3682-014", "name": "item", "description": "10.3832/ifor3682-014", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.3832/ifor3682-014"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-12-31T00:00:00Z"}}, {"id": "10.5061/dryad.07hc0m4", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:22:21Z", "type": "Dataset", "title": "Data from: Variation in home-field advantage and ability in leaf litter decomposition across successional gradients", "description": "Open AccessMass loss and  environmental data - Veen et al 2018 - Functional  EcologyData file including  litter mass loss data, soil abiotic properties and litter chemical  properties for Veen et al 2018 (Functional Ecology)Veen et al  FE-data.xlsx", "keywords": ["decomposition", "functional breadth", "Verwerkte data", "Processed data", "15. Life on land", "plant-litter feedback", "soil", "succession"], "contacts": [{"organization": "Veen, G.F. Ciska, Keiser, Ashley D., van der Putten, Wim H., Wardle, David A., Veen, G. F. Ciska,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.07hc0m4"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.07hc0m4", "name": "item", "description": "10.5061/dryad.07hc0m4", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.07hc0m4"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-01-01T00:00:00Z"}}, {"id": "10.5061/dryad.11m00", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:22:22Z", "type": "Dataset", "title": "Data from: Shrub encroachment can reverse desertification in semi-arid Mediterranean grasslands", "description": "unspecifiedEnvironmental and soil  data from encroached/unencroached Stipa tenacissima steppes from  SpainEnvironmental  (coordinates, elevation, slope, aspect, mean annual rainfall and  temperature) and soil (pH, organic carbon, total nitrogen, total  phosphorus, soil respiration, potassium and nitrogen mineralization)  variables at the microsite and site scales for Stipa tenacissima  grasslands with and without sprouting shrubs in a gradient from central to  southern Spain.Ecol_Lett_2009.zip", "keywords": ["2. Zero hunger", "Stipa tenacissima", "Holocene", "13. Climate action", "semi-arid", "15. Life on land", "Plant successional dynamics", "shrub encroachment", "Desertification"], "contacts": [{"organization": "Maestre, Fernando T., Bowker, Matthew A., Puche, Mar\u00eda D., Bel\u00e9n Hinojosa, M., Mart\u00ednez, Isabel, Garc\u00eda-Palacios, Pablo, Castillo, Andrea P., Soliveres, Santiago, Luzuriaga, Ar\u00e1ntzazu L., S\u00e1nchez, Ana M., Carreira, Jos\u00e9 A., Gallardo, Antonio, Escudero, Adri\u00e1n,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5061/dryad.11m00"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.11m00", "name": "item", "description": "10.5061/dryad.11m00", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.11m00"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2013-08-13T00:00:00Z"}}, {"id": "10.5061/dryad.rn8pk0ph5", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:22:33Z", "type": "Dataset", "title": "Drivers of soil organic carbon stock during tropical forest succession", "description": "Soil organic matter contributes to productivity in terrestrial ecosystems  and contains more carbon than is found in the atmosphere. Yet, there is  little understanding of soil organic carbon (SOC) sequestration processes  during tropical forest succession, particularly after land abandonment  from agriculture practices. Here we used vegetation and environmental data  from two large-scale surveys covering a total landscape area of 20,000 ha  in Southeast Asia to investigate the effects of plant species diversity,  functional trait diversity, phylogenetic diversity, aboveground biomass,  and environmental factors on SOC sequestration during forest succession.  We found that functional trait diversity plays an important role in  determining SOC sequestration across successional trajectories. Increases  in SOC carbon storage were associated with indirect positive effects of  species diversity and succession age via functional trait diversity, but  phylogenetic diversity and aboveground biomass showed no significant  relationship with SOC stock. Furthermore, the effects of soil properties  and functional trait diversity on SOC carbon storage shift across  elevation. Synthesis: Our results suggest that reforestation and  restoration management practices that implement a trait-based approach by  combining long-lived and short-lived species (conservative and acquisitive  traits) to increase plant functional diversity could enhance SOC  sequestration for climate change mitigation and adaptation efforts, as  well as accelerate recovery of healthy soils.", "keywords": ["2. Zero hunger", "tropical forest", "FOS: Agriculture", " forestry", " and fisheries", "15. Life on land", "forest soil", "functional diversity", "plant diversity", "swidden agriculture", "soil organic carbon", "13. Climate action", "forest succession", "functional traits", "tropical forest ecology", "soil carbon stock"]}, "links": [{"href": "https://doi.org/10.5061/dryad.rn8pk0ph5"}, {"rel": "self", "type": "application/geo+json", "title": "10.5061/dryad.rn8pk0ph5", "name": "item", "description": "10.5061/dryad.rn8pk0ph5", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5061/dryad.rn8pk0ph5"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-05-26T00:00:00Z"}}, {"id": "10.5281/zenodo.5348287", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:24:28Z", "type": "Dataset", "title": "Annual maps of cropland abandonment, land cover, and other derived data for time-series analysis of cropland abandonment", "description": "Open AccessThis archive contains raw annual land cover maps, cropland abandonment maps, and accompanying derived data products to support: Crawford C.L., Yin, H., Radeloff, V.C., and Wilcove, D.S. 2022. Rural land abandonment is too ephemeral to provide major benefits for biodiversity and climate. <em>Science Advances</em> doi.org/10.1126/sciadv.abm8999<em>.</em> An archive of the analysis scripts developed for this project can be found at: https://github.com/chriscra/abandonment_trajectories (https://doi.org/10.5281/zenodo.6383127). Note that the label '_2022_02_07' in many file names refers to the date of the primary analysis. 'dts\u201d or \u201cdt\u201d refer to \u201cdata.tables,' large .csv files that were manipulated using the data.table package in R (Dowle and Srinivasan 2021, http://r-datatable.com/). \u201cRasters\u201d refer to \u201c.tif\u201d files that were processed using the raster and terra packages in R (Hijmans, 2022; https://rspatial.org/terra/; https://rspatial.org/raster). Data files fall into one of four categories of data derived during our analysis of abandonment: <strong>observed</strong>, <strong>potential</strong>, <strong>maximum</strong>, or <strong>recultivation</strong>. Derived datasets also follow the same naming convention, though are aggregated across sites. These four categories are as follows (using \u201cage_dts\u201d for our site in Shaanxi Province, China as an example): <strong>observed</strong> abandonment identified through our primary analysis, with a threshold of five years. These files do not have a specific label beyond the description of the file and the date of analysis (e.g., shaanxi_age_2022_02_07.csv); <strong>potential</strong> abandonment for a scenario without any recultivation, in which abandoned croplands are left abandoned from the year of initial abandonment through the end of the time series, with the label \u201c_potential\u201d (e.g., shaanxi_potential_age_2022_02_07.csv); <strong>maximum</strong> age of abandonment over the course of the time series, with the label \u201c_max\u201d (e.g., shaanxi_max_age_2022_02_07.csv); <strong>recultivation </strong>periods, corresponding to the lengths of recultivation periods following abandonment, given the label \u201c_recult\u201d (e.g., shaanxi_recult_age_2022_02_07.csv). <strong>This archive includes multiple .zip files, the contents of which are described below:</strong> <strong>age_dts.zip</strong> - Maps of abandonment age (i.e., how long each pixel has been abandoned for, as of that year, also referred to as length, duration, etc.), for each year between 1987-2017 for all 11 sites. These maps are stored as .csv files, where each row is a pixel, the first two columns refer to the x and y coordinates (in terms of longitude and latitude), and subsequent columns contain the abandonment age values for an individual year (where years are labeled with 'y' followed by the year, e.g., 'y1987'). Maps are given with a latitude and longitude coordinate reference system. Folder contains observed age, potential age (\u201c_potential\u201d), maximum age (\u201c_max\u201d), and recultivation lengths (\u201c_recult\u201d) for all sites. Maximum age .csv files include only three columns: x, y, and the maximum length (i.e., \u201cmax age\u201d, in years) for each pixel throughout the entire time series (1987-2017). Files were produced using the custom functions 'cc_filter_abn_dt(),' \u201ccc_calc_max_age(),' \u201ccc_calc_potential_age(),\u201d and \u201ccc_calc_recult_age();\u201d see '_util/_util_functions.R.' <strong>age_rasters.zip</strong> - Maps of abandonment age (i.e., how long each pixel has been abandoned for), for each year between 1987-2017 for all 11 sites. Maps are stored as .tif files, where each band corresponds to one of the 31 years in our analysis (1987-2017), in ascending order (i.e., the first layer is 1987 and the 31st layer is 2017). Folder contains observed age, potential age (\u201c_potential\u201d), and maximum age (\u201c_max\u201d) rasters for all sites. Maximum age rasters include just one band (\u201clayer\u201d). These rasters match the corresponding .csv files contained in 'age_dts.zip.\u201d <strong>derived_data.zip</strong> - summary datasets created throughout this analysis, listed below. <strong>diff.zip</strong> - .csv files for each of our eleven sites containing the year-to-year lagged differences in abandonment age (i.e., length of time abandoned) for each pixel. The rows correspond to a single pixel of land, and the columns refer to the year the difference is in reference to. These rows do not have longitude or latitude values associated with them; however, rows correspond to the same rows in the .csv files in 'input_data.tables.zip' and 'age_dts.zip.' These files were produced using the custom function 'cc_diff_dt()' (much like the base R function 'diff()'), contained within the custom function 'cc_filter_abn_dt()' (see '_util/_util_functions.R'). Folder contains diff files for observed abandonment, potential abandonment (\u201c_potential\u201d), and recultivation lengths (\u201c_recult\u201d) for all sites. <strong>input_dts.zip</strong> - annual land cover maps for eleven sites with four land cover classes (see below), adapted from Yin et al. 2020 <em>Remote Sensing of Environment </em>(https://doi.org/10.1016/j.rse.2020.111873)<em>. </em>Like \u201cage_dts,\u201d these maps are stored as .csv files, where each row is a pixel and the first two columns refer to x and y coordinates (in terms of longitude and latitude). Subsequent columns contain the land cover class for an individual year (e.g., 'y1987'). Note that these maps were recoded from Yin et al. 2020 so that land cover classification was consistent across sites (see below). This contains two files for each site: the raw land cover maps from Yin et al. 2020 (after recoding), and a \u201cclean\u201d version produced by applying 5- and 8-year temporal filters to the raw input (see custom function \u201ccc_temporal_filter_lc(),\u201d in \u201c_util/_util_functions.R\u201d and \u201c1_prep_r_to_dt.R\u201d). These files correspond to those in 'input_rasters.zip,' and serve as the primary inputs for the analysis. <strong>input_rasters.zip</strong> - annual land cover maps for eleven sites with four land cover classes (see below), adapted from Yin et al. 2020 <em>Remote Sensing of Environment. </em>Maps are stored as '.tif' files, where each band corresponds one of the 31 years in our analysis (1987-2017), in ascending order (i.e., the first layer is 1987 and the 31st layer is 2017). Maps are given with a latitude and longitude coordinate reference system. Note that these maps were recoded so that land cover classes matched across sites (see below). Contains two files for each site: the raw land cover maps (after recoding), and a \u201cclean\u201d version that has been processed with 5- and 8-year temporal filters (see above). These files match those in 'input_dts.zip.' <strong>length.zip</strong> - .csv files containing the length (i.e., age or duration, in years) of each distinct individual period of abandonment at each site. This folder contains length files for observed and potential abandonment, as well as recultivation lengths. Produced using the custom function 'cc_filter_abn_dt()' and \u201ccc_extract_length();\u201d see '_util/_util_functions.R.' <strong>derived_data.zip</strong> contains the following files: '<strong>site_df.csv</strong>' - a simple .csv containing descriptive information for each of our eleven sites, along with the original land cover codes used by Yin et al. 2020 (updated so that all eleven sites in how land cover classes were coded; see below). <strong>Primary derived datasets </strong>for both observed abandonment (\u201carea_dat\u201d) and potential abandonment (\u201cpotential_area_dat\u201d). <strong>area_dat</strong> - Shows the area (in ha) in each land cover class at each site in each year (1987-2017), along with the area of cropland abandoned in each year following a five-year abandonment threshold (abandoned for &gt;=5 years) or no threshold (abandoned for &gt;=1 years). Produced using custom functions 'cc_calc_area_per_lc_abn()' via 'cc_summarize_abn_dts()'. See scripts 'cluster/2_analyze_abn.R' and '_util/_util_functions.R.' <strong>persistence_dat</strong> - A .csv containing the area of cropland abandoned (ha) for a given 'cohort' of abandoned cropland (i.e., a group of cropland abandoned in the same year, also called 'year_abn') in a specific year. This area is also given as a proportion of the initial area abandoned in each cohort, or the area of each cohort when it was first classified as abandoned at year 5 ('initial_area_abn'). The 'age' is given as the number of years since a given cohort of abandoned cropland was last actively cultivated, and 'time' is marked relative to the 5th year, when our five-year definition first classifies that land as abandoned (and where the proportion of abandoned land remaining abandoned is 1). Produced using custom functions 'cc_calc_persistence()' via 'cc_summarize_abn_dts()'. See scripts 'cluster/2_analyze_abn.R' and '_util/_util_functions.R.' This serves as the main input for our linear models of recultivation (\u201cdecay\u201d) trajectories. <strong>turnover_dat</strong> - A .csv showing the annual gross gain, annual gross loss, and annual net change in the area (in ha) of abandoned cropland at each site in each year of the time series. Produced using custom functions 'cc_calc_abn_diff()' via 'cc_summarize_abn_dts()' (see '_util/_util_functions.R'), implemented in 'cluster/2_analyze_abn.R.' This file is only produced for observed abandonment. <strong>Area summary files </strong>(for observed abandonment only) <strong>area_summary_df</strong> - Contains a range of summary values relating to the area of cropland abandonment for each of our eleven sites. All area values are given in hectares (ha) unless stated otherwise. It contains 16 variables as columns, including 1) 'site,' 2) 'total_site_area_ha_2017' - the total site area (ha) in 2017, 3) 'cropland_area_1987' - the area in cropland in 1987 (ha), 4) 'area_abn_ha_2017' - the area of cropland abandoned as of 2017 (ha), 5) 'area_ever_abn_ha' - the total area of those pixels that were abandoned at least once during the time series (corresponding to the area of potential abandonment, as of 2017), 6) 'total_crop_extent_ha' - the total area of those pixels that were classified as cropland at least once during the time series, 7) 'total_area_abn_remaining_2017' - duplicate of 'area_abn_ha_2017,' the area abandoned as of 2017 (ha), taken from 'area_recult_threshold,' 8) 'total_initial_area_abn' - the sum of the initial area of each cohort of abandonment when it is first classified as 'abandoned,' i.e., at the 5 year mark (note that this is cumulative, and because it counts those pixels that were abandoned more than once, it is therefore larger than 'area_ever_abn_ha'), taken from 'area_recult_threshold' 9) 'total_area_abn_recultivated_2017' - the area of abandoned land that was recultivated as of 2017 (cumulatively, i.e., 'total_initial_area_abn' - 'area_abn_ha_2017'), taken from 'area_recult_threshold,' 10) 'proportion_recultivated' - the proportion of all abandoned cropland (including multiple periods per pixel) that was recultivated by 2017, taken from 'area_recult_threshold,' 11) 'area_2017_as_prop_site' - area abandoned as of 2017 as a proportion of the total site area, 12) 'area_2017_as_prop_total_crop' - area abandoned as of 2017 as a proportion of the total crop extent, 13) 'area_2017_as_prop_crop87' - area abandoned as of 2017 as a proportion of cropland area in 1987, 14) 'area_ever_abn_as_prop_site' - area ever abandoned as a proportion of the total site area, 15) 'area_ever_abn_as_prop_total_crop' - area ever abandoned as a proportion of the total crop extent, 16) 'area_ever_abn_as_prop_crop87' - area ever abandoned as a proportion of cropland area in 1987. See script '1_summary_stats.Rmd.' <strong>area_recult_threshold</strong> - Contains data on the proportion of observed abandoned cropland area that is recultivated by the end of our time series. This includes the area of abandoned cropland as of 2017 ('total_area_abn_remaining_2017') and the sum of the initial area of each cohort of abandonment when it is first classified as abandoned (at year 5; 'total_initial_area_abn'). This 'total_initial_area_abn' is cumulative, and allows for pixels that were abandoned multiple times during the time series to be counted multiple times. The difference between these two columns yields the 'total_area_abn_recultivated_2017,' which in turn is used to calculate the 'proportion_recultivated,' and the (ascending) 'order' of sites based on this proportion. This file includes recultivation stats for each site for three abandonment definitions: 5, 7, and 10 years. See script '1_summary_stats.Rmd.' <strong>abn_lc_area_2017</strong> - Contains the number of pixels and corresponding area (in ha) of abandoned cropland in the year 2017 at each site, according to the land cover class (either woody vegetation [2], or herbaceous vegetation [4]) and the age in 2017 (5 to 30 years). See script 'cluster/6_lc_of_abn.R.' <strong>abn_prop_lc_2017 </strong>- Contains the number of pixels and corresponding area (ha) of cropland abandoned in the year 2017 in each land cover type (woody vegetation [2], or herbaceous vegetation [4]). It also shows this area as a proportion of the total area abandoned at each site (i.e., in either land cover class: 2 or 4). See script 'cluster/6_lc_of_abn.R.' <strong>Carbon</strong> <strong>carbon_df </strong>\u2013 contains the observed and potential carbon accumulation in abandoned croplands in each site in each year (in Mg C), for two abandonment thresholds: 5 years (our default abandonment definition) and 1 year (i.e., no threshold). Each data point corresponds to one of two scenarios (\u201ctype\u201d column), either \u201cobserved\u201d or \u201cpotential.\u201d Carbon accumulation figures are for both the sum of forest and soil carbon at each site in a given year. Carbon accumulation is listed in three columns: 1) \u201cC_up_to_20\u201d contains the total carbon accumulated in those abandoned croplands with abandonment durations between 5 and 20 years. 2) \u201cC_21_30\u201d contains the total carbon accumulation in croplands with durations between 21 and 30 years, which are differentiated in order to account for non-linear carbon accumulation rates in soils over time, and 3) \u201ctotal_C_Mg\u201d contains the sum of the previous two columns, representing the total carbon accumulated across all abandoned croplands in each year. <strong>soc_mean</strong> \u2013 contains mean soil organic carbon accumulation rates for years 1-20 and years 21-80, derived from Sanderman et al. 2020 (in Mg C; https://doi.org/10.7910/DVN/HA17D3). These values correspond to accumulation rates in croplands upon abandonment and regeneration to natural vegetation (Sanderman et al. 2020\u2019s \u201crewilding\u201d scenario). These mean values are calculated across those pixels identified as cropland by Sanderman et al. 2020 at each site. Mean values in year 20 and 80 are contained in columns \u201cmean_soc_20\u201d and \u201cmean_soc_80\u201d respectively, and the annualized rate over the first 20 years and the subsequent years 21 through 80 are contained in columns \u201cmean_annual_soc_1_20\u201d and \u201cmean_annual_soc_21_80\u201d respectively. <strong>Decay model data</strong> \u2013 two R data files containing data products for our linear models of abandonment recultivation trajectories. <strong>decay_endpoints_files</strong> \u2013 an R data file (.rds) containing seven data products produced as part of our common endpoint analysis, which calculated mean trajectories for each site across a range of common endpoints, ensuring that means were based on coefficient estimates derived from a consistent number of observations for each cohort. These files are: <strong>common_endpoint_dat \u2013 </strong>a .csv containing subsets of \u201cpersistence_dat\u201d for each \u201cendpoint\u201d (7 through 29). <strong>endpoint_n \u2013 </strong>a .csv describing, for each endpoint, the corresponding number of observations per cohort (\u201cn_obs\u201d), the number of cohorts (\u201cn_cohorts\u201d), the total number of observations across cohorts included (\u201ctotal_obs\u201d), and the cohorts that meet the endpoint threshold (\u201ccohorts\u201d). <strong>coef_l3_endpoints \u2013 </strong>corresponding model coefficients for our primary model (\u201cl3\u201d) parameterized by the range of subsets across endpoints. <strong>augment_endpoints \u2013 </strong>fitted values (i.e., model predictions) for linear models produced across the full range of endpoint subsets. <strong>fitted_endpoints \u2013 </strong>a simplified .csv containing the mean linear and log coefficients for each site at each endpoint, and the corresponding predicted proportion remaining abandoned through time (based on the \u201cage,\u201d or duration, of abandonment). <strong>time_to_endpoints \u2013 </strong>a .csv containing, for mean trajectories for each endpoint at each site, the estimated time required for a given amount of abandoned cropland in a cohort to be recultivated (deciles, 10% through 100%). <strong>endpoint_half_lives \u2013 </strong>a .csv containing the half-lives calculated for the mean trajectories for each endpoint at each site. <strong>decay_mod_archive</strong> - an R data file (.rds) containing eleven data products derived from linear models of abandonment recultivation ('decay'): <strong>lm_mega_lin_log_lin_l</strong> \u2013 the primary linear model produced in our analysis. This model is referred to as \u201clin_log_lin\u201d (or \u201cl3\u201d) because the model predicts linear persistence (\u201clin\u201d) as a function of a log term of time (\u201clog\u201d) and a linear term of time (\u201clin\u201d). \u201cmega\u201d refers to the fact that this model is run for the full dataset, pooled acro", "keywords": ["2. Zero hunger", "Carbon sequestration", "Cropland abandonment", "13. Climate action", "Agricultural abandonment", "Agriculture", "15. Life on land", "Land-cover mapping", "Farmland abandonment", "Biodiversity conservation", "Secondary succession"], "contacts": [{"organization": "Crawford, Christopher L., Yin, He, Radeloff, Volker C., Wilcove, David S.,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5281/zenodo.5348287"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.5348287", "name": "item", "description": "10.5281/zenodo.5348287", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.5348287"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-03-26T00:00:00Z"}}, {"id": "10481/81450", "type": "Feature", "geometry": null, "properties": {"license": "Atribuci\u00f3n 4.0 Internacional", "updated": "2026-07-27T16:26:03Z", "type": "Report", "title": "Spontaneous Primary Succession and Vascular Plant Recovery in the Iberian Gypsum Quarries: Insights for Ecological Restoration in an EU Priority Habitat", "description": "Atribuci\u00f3n 4.0 InternacionalGypsum covers a vast area of the Iberian Peninsula, making Spain a leader in its production. Gypsum is a fundamental raw material for modern societies. However, gypsum quarries have an obvious impact on the landscape and biodiversity. Gypsum outcrops host a high percentage of endemic plants and unique vegetation, considered a priority by the EU. Restoring gypsum areas after mining is a key strategy to prevent biodiversity loss. For the implementation of restoration approaches, understanding vegetation\u2019s successional processes can be of invaluable help. To fully document the spontaneous succession in gypsum quarries and to evaluate its interest for restoration, 10 permanent plots of 20 \u00d7 50 m were proposed, with nested subplots, in which vegetation change was recorded for 13 years in Almeria (Spain). Through Species-Area Relationships (SARs), these plots\u2019 floristic changes were monitored and compared to others in which an active restoration was carried out, as well as others with natural vegetation. Furthermore, the successional pattern found was compared to those recorded in 28 quarries distributed throughout the Spanish territory. The results show that an ecological pattern of spontaneous primary auto-succession is widely recurring in Iberian gypsum quarries, which is capable of regenerating the pre-existing natural vegetation.", "keywords": ["2. Zero hunger", "Passive restoration", "Permanent plots", "Gypsum mining", "Successional chronosequence", "15. Life on land", "Species-Area Relationships (SAR)", "Gypsophile", "12. Responsible consumption"], "contacts": [{"organization": "Mota, Juan Francisco, Mendoza Fern\u00e1ndez, Antonio Jes\u00fas,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10481/81450"}, {"rel": "self", "type": "application/geo+json", "title": "10481/81450", "name": "item", "description": "10481/81450", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10481/81450"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-05-11T00:00:00Z"}}, {"id": "10486/708477", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:26:03Z", "type": "Journal Article", "created": "2023-04-21", "title": "Field scale biodegradation of total petroleum hydrocarbons and soil restoration by Ecopiles: microbiological analysis of the process", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Ecopiling is a method for biodegradation of hydrocarbons in soils. It derives from Biopiles, but phytoremediation is added to biostimulation with nitrogen fertilization and bioaugmentation with local bacteria. We have constructed seven Ecopiles with soil heavily polluted with hydrocarbons in Carlow (Ireland). The aim of the study was to analyze changes in the microbial community during ecopiling. In the course of 18\u2009months of remediation, total petroleum hydrocarbons values decreased in 99 and 88% on average for aliphatics and aromatics, respectively, indicating a successful biodegradation. Community analysis showed that bacterial alfa diversity (Shannon Index), increased with the degradation of hydrocarbons, starting at an average value of 7.59 and ending at an average value of 9.38. Beta-diversity analysis, was performed using Bray-Curtis distances and PCoA ordination, where the two first principal components (PCs) explain the 17 and 14% of the observed variance, respectively. The results show that samples tend to cluster by sampling time instead of by Ecopile. This pattern is supported by the hierarchical clustering analysis, where most samples from the same timepoint clustered together. We used DSeq2 to determine the differential abundance of bacterial populations in Ecopiles at the beginning and the end of the treatment. While TPHs degraders are more abundant at the start of the experiment, these populations are substituted by bacterial populations typical of clean soils by the end of the biodegradation process. Similar results are found for the fungal community, indicating that the microbial community follows a succession along the process. This succession starts with a TPH degraders or tolerant enriched community, and finish with a microbial community typical of clean soils.</p></article>", "keywords": ["hydrocarbon", "bioremediation", "microbial succession", "microbiota", "Ecopile", "15. Life on land", "Biolog\u00eda y Biomedicina / Biolog\u00eda", "Microbiology", "6. Clean water", "QR1-502"]}, "links": [{"href": "https://doi.org/10486/708477"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10486/708477", "name": "item", "description": "10486/708477", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10486/708477"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-04-21T00:00:00Z"}}, {"id": "10754/685569", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:26:06Z", "type": "Journal Article", "created": "2022-11-03", "title": "Environmental micro\u2010niche filtering shapes bacterial pioneer communities during primary colonization of a Himalayas' glacier forefield", "description": "Abstract<p>The pedogenesis from the mineral substrate released upon glacier melting has been explained with the succession of consortia of pioneer microorganisms, whose structure and functionality are determined by the environmental conditions developing in the moraine. However, the microbiome variability that can be expected in the environmentally heterogeneous niches occurring in a moraine at a given successional stage is poorly investigated. In a 50\uffe2\uff80\uff89m2 area in the forefield of the Lobuche glacier (Himalayas, 5050\uffe2\uff80\uff89m above sea level), we studied six sites of primary colonization presenting different topographical features (orientation, elevation and slope) and harbouring greyish/dark biological soil crusts (BSCs). The spatial vicinity of the sites opposed to their topographical differences, allowed us to examine the effect of environmental conditions independently from the time of deglaciation. The bacterial microbiome diversity and their co\uffe2\uff80\uff90occurrence network, the bacterial metabolisms predicted from 16S rRNA gene high\uffe2\uff80\uff90throughput sequencing, and the microbiome intact polar lipids were investigated in the BSCs and the underlying sediment deep layers (DLs). Different bacterial microbiomes inhabited the BSCs and the DLs, and their composition varied among sites, indicating a niche\uffe2\uff80\uff90specific role of the micro\uffe2\uff80\uff90environmental conditions in the bacterial communities' assembly. In the heterogeneous sediments of glacier moraines, physico\uffe2\uff80\uff90chemical and micro\uffe2\uff80\uff90climatic variations at the site\uffe2\uff80\uff90spatial scale are crucial in shaping the microbiome microvariability and structuring the pioneer bacterial communities during pedogenesis.</p", "keywords": ["0301 basic medicine", "Pedogenesis", "0303 health sciences", "Glacier Foreland Succession", "Bacteria", "Biological soil crust", "15. Life on land", "Primary Colonization", "Soil", "03 medical and health sciences", "13. Climate action", "RNA", " Ribosomal", " 16S", "Glacier Moraines", "Cold Deserts", "Pioneer Bacterial Communities", "Ice Cover", "Soil moisture", "Research Articles", "Soil Microbiology"]}, "links": [{"href": "https://air.unimi.it/bitstream/2434/949070/2/Rolli%20et%20al%202022%20Environmental%20micro%e2%80%90niche%20filtering%20shapes%20bacterial%20pioneer%20communities.pdf"}, {"href": "https://eprints.ncl.ac.uk/fulltext.aspx?url=302678/40A25368-9064-4886-B8E6-E7942511FA71.pdf&pub_id=302678"}, {"href": "https://doi.org/10754/685569"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Environmental%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10754/685569", "name": "item", "description": "10754/685569", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10754/685569"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-18T00:00:00Z"}}, {"id": "10835/14411", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-07-27T16:26:07Z", "type": "Journal Article", "created": "2023-03-06", "title": "Spontaneous Primary Succession and Vascular Plant Recovery in the Iberian Gypsum Quarries: Insights for Ecological Restoration in an EU Priority Habitat", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Gypsum covers a vast area of the Iberian Peninsula, making Spain a leader in its production. Gypsum is a fundamental raw material for modern societies. However, gypsum quarries have an obvious impact on the landscape and biodiversity. Gypsum outcrops host a high percentage of endemic plants and unique vegetation, considered a priority by the EU. Restoring gypsum areas after mining is a key strategy to prevent biodiversity loss. For the implementation of restoration approaches, understanding vegetation\u2019s successional processes can be of invaluable help. To fully document the spontaneous succession in gypsum quarries and to evaluate its interest for restoration, 10 permanent plots of 20 \u00d7 50 m were proposed, with nested subplots, in which vegetation change was recorded for 13 years in Almeria (Spain). Through Species-Area Relationships (SARs), these plots\u2019 floristic changes were monitored and compared to others in which an active restoration was carried out, as well as others with natural vegetation. Furthermore, the successional pattern found was compared to those recorded in 28 quarries distributed throughout the Spanish territory. The results show that an ecological pattern of spontaneous primary auto-succession is widely recurring in Iberian gypsum quarries, which is capable of regenerating the pre-existing natural vegetation.</p></article>", "keywords": ["2. Zero hunger", "Botany", "Passive restoration", "15. Life on land", "Species-Area Relationships (SAR)", "Article", "12. Responsible consumption", "QK1-989", "Permanent plots", "Gypsum mining", "gypsum mining", "Successional chronosequence", "permanent plots", "passive restoration", "gypsophil", "successional chronosequence", "Gypsophile"]}, "links": [{"href": "http://www.mdpi.com/2223-7747/12/5/1162/pdf"}, {"href": "https://www.mdpi.com/2223-7747/12/5/1162/pdf"}, {"href": "https://doi.org/10835/14411"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Plants", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10835/14411", "name": "item", "description": "10835/14411", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10835/14411"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-03-03T00:00:00Z"}}, {"id": "3171272055", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:27:41Z", "type": "Journal Article", "created": "2021-06-07", "title": "Dynamics of Soil Bacterial and Fungal Communities During the Secondary Succession Following Swidden Agriculture IN Lowland Forests", "description": "<p>Elucidating dynamics of soil microbial communities after disturbance is crucial for understanding ecosystem restoration and sustainability. However, despite the widespread practice of swidden agriculture in tropical forests, knowledge about microbial community succession in this system is limited. Here, amplicon sequencing was used to investigate effects of soil ages (spanning at least 60 years) after disturbance, geographic distance (from 0.1 to 10 km) and edaphic property gradients (soil pH, conductivity, C, N, P, Ca, Mg, and K), on soil bacterial and fungal communities along a chronosequence of sites representing the spontaneous succession following swidden agriculture in lowland forests in Papua New Guinea. During succession, bacterial communities (OTU level) as well as its abundant (OTU with relative abundance &amp;gt; 0.5%) and rare (&amp;lt;0.05%) subcommunities, showed less variation but more stage-dependent patterns than those of fungi. Fungal community dynamics were significantly associated only with geographic distance, whereas bacterial community dynamics were significantly associated with edaphic factors and geographic distance. During succession, more OTUs were consistently abundant (n = 12) or rare (n = 653) for bacteria than fungi (abundant = 6, rare = 5), indicating bacteria were more tolerant than fungi to environmental gradients. Rare taxa showed higher successional dynamics than abundant taxa, and rare bacteria (mainly from Actinobacteria, Proteobacteria, Acidobacteria, and Verrucomicrobia) largely accounted for bacterial community development and niche differentiation during succession.</p", "keywords": ["tropical forests", "0301 basic medicine", "0303 health sciences", "03 medical and health sciences", "soil microbiome", "11. Sustainability", "ecological succession", "15. Life on land", "rare bacteria and fungi", "Microbiology", "slash-and-burn", "QR1-502"]}, "links": [{"href": "https://doi.org/3171272055"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "3171272055", "name": "item", "description": "3171272055", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/3171272055"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-07T00:00:00Z"}}, {"id": "50|od______1648::0a8660ae07fc90dcc5c331bacea8b751", "type": "Feature", "geometry": null, "properties": {"license": "Atribuci\u00f3n 4.0 Internacional", "updated": "2026-07-27T16:28:20Z", "type": "Report", "title": "Spontaneous Primary Succession and Vascular Plant Recovery in the Iberian Gypsum Quarries: Insights for Ecological Restoration in an EU Priority Habitat", "description": "Atribuci\u00f3n 4.0 InternacionalGypsum covers a vast area of the Iberian Peninsula, making Spain a leader in its production. Gypsum is a fundamental raw material for modern societies. However, gypsum quarries have an obvious impact on the landscape and biodiversity. Gypsum outcrops host a high percentage of endemic plants and unique vegetation, considered a priority by the EU. Restoring gypsum areas after mining is a key strategy to prevent biodiversity loss. For the implementation of restoration approaches, understanding vegetation\u2019s successional processes can be of invaluable help. To fully document the spontaneous succession in gypsum quarries and to evaluate its interest for restoration, 10 permanent plots of 20 \u00d7 50 m were proposed, with nested subplots, in which vegetation change was recorded for 13 years in Almeria (Spain). Through Species-Area Relationships (SARs), these plots\u2019 floristic changes were monitored and compared to others in which an active restoration was carried out, as well as others with natural vegetation. Furthermore, the successional pattern found was compared to those recorded in 28 quarries distributed throughout the Spanish territory. The results show that an ecological pattern of spontaneous primary auto-succession is widely recurring in Iberian gypsum quarries, which is capable of regenerating the pre-existing natural vegetation.", "keywords": ["2. Zero hunger", "Passive restoration", "Permanent plots", "Gypsum mining", "Successional chronosequence", "15. Life on land", "Species-Area Relationships (SAR)", "Gypsophile", "12. Responsible consumption"], "contacts": [{"organization": "Mota, Juan Francisco, Mendoza Fern\u00e1ndez, Antonio Jes\u00fas,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/50|od______1648::0a8660ae07fc90dcc5c331bacea8b751"}, {"rel": "self", "type": "application/geo+json", "title": "50|od______1648::0a8660ae07fc90dcc5c331bacea8b751", "name": "item", "description": "50|od______1648::0a8660ae07fc90dcc5c331bacea8b751", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/50|od______1648::0a8660ae07fc90dcc5c331bacea8b751"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-05-11T00:00:00Z"}}, {"id": "PMC8215787", "type": "Feature", "geometry": null, "properties": {"updated": "2026-07-27T16:30:29Z", "type": "Journal Article", "created": "2021-06-07", "title": "Dynamics of Soil Bacterial and Fungal Communities During the Secondary Succession Following Swidden Agriculture IN Lowland Forests", "description": "<p>Elucidating dynamics of soil microbial communities after disturbance is crucial for understanding ecosystem restoration and sustainability. However, despite the widespread practice of swidden agriculture in tropical forests, knowledge about microbial community succession in this system is limited. Here, amplicon sequencing was used to investigate effects of soil ages (spanning at least 60 years) after disturbance, geographic distance (from 0.1 to 10 km) and edaphic property gradients (soil pH, conductivity, C, N, P, Ca, Mg, and K), on soil bacterial and fungal communities along a chronosequence of sites representing the spontaneous succession following swidden agriculture in lowland forests in Papua New Guinea. During succession, bacterial communities (OTU level) as well as its abundant (OTU with relative abundance &amp;gt; 0.5%) and rare (&amp;lt;0.05%) subcommunities, showed less variation but more stage-dependent patterns than those of fungi. Fungal community dynamics were significantly associated only with geographic distance, whereas bacterial community dynamics were significantly associated with edaphic factors and geographic distance. During succession, more OTUs were consistently abundant (n = 12) or rare (n = 653) for bacteria than fungi (abundant = 6, rare = 5), indicating bacteria were more tolerant than fungi to environmental gradients. Rare taxa showed higher successional dynamics than abundant taxa, and rare bacteria (mainly from Actinobacteria, Proteobacteria, Acidobacteria, and Verrucomicrobia) largely accounted for bacterial community development and niche differentiation during succession.</p", "keywords": ["tropical forests", "0301 basic medicine", "0303 health sciences", "03 medical and health sciences", "soil microbiome", "11. Sustainability", "ecological succession", "15. Life on land", "rare bacteria and fungi", "Microbiology", "slash-and-burn", "QR1-502"]}, "links": [{"href": "https://doi.org/PMC8215787"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Frontiers%20in%20Microbiology", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "PMC8215787", "name": "item", "description": "PMC8215787", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/PMC8215787"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2021-06-07T00:00:00Z"}}, {"id": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[6.16, 50.16], [6.16, 51.32], [7.61, 51.32], [7.61, 50.16], [6.16, 50.16]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "GEMET - Concepts, version 2.4"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Inplamint's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Inplamint and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-04-15", "type": "Dataset", "created": "2023-01-24", "language": "eng", "title": "Soil fungal community across a 52-year chronosequence of soil recultivation after open-mining in Inden, Germany", "description": "The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6\u00b015\u20190\u2019 E to 6\u00b021\u20190\u2019 E and 50\u00b050\u20195\u2019 N to 50\u00b053\u20190\u2019 N) of an open-cast lignite mine at Inden, between Cologne, Aachen, M\u00f6nchengladbach, and D\u00fcsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years, at samling time of 2016. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha\u22121 a\u22121 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). They are a total of 115 samples (5 replicates per field x 2 seasons, each field corresponds to a year of recultivation). Four samples were removed due to failed PCR. The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5\u2032\u2010GTGARTCATCGAATCTTTG\u20103\u2032 / ITS4: 5\u2032\u2010TCCTCCGCTTATTGATATGC\u20103\u2032). Amplicon sequence variants (ASVs) were inferred using DADA2 in R. Taxonomic annotations were performed using the IDTaxa algorithm implemented in the DECIPHER R package, against UNITE (version of 10.05.2021). Raw sequencing reads are available at ENA under study project PRJEB51095. The DNA sequences of the fungal amplicon sequence variants are available at ENA under accession numbers OV986018-OV989728. The processed dataset including the ASV count table, ASV taxonomy, and sample metadata compiled as a phyloseq R object stored in a single .RDS R file, as well as ASV guild annotation using Funguild database, are available at figshare at (https://doi.org/10.6084/m9.figshare.20160578). To read the data in the software R, use readRDS() function). Here we upload at the BONARES data centre the relative abundance of each fungal guild (% of DNA sequences) per samples along with basic metadata for easy reuse. The guild name and metadata name is provided in the header of each column. The entire set of measured soil physico-chemical parameters has been deposited at BONARES under reference 72ca6e98-5aab-4884-bf1b-56931482eb94. The publication associated to the dataset can be found at https://doi.org/10.1007/s00248-022-02058-w. Roy J, Reichel R, Br\u00fcggemann N, Rillig MC. 2022. Functional, not Taxonomic, Composition of Soil Fungi Reestablishes to Pre   mining Initial State After 52 Years of Recultivation. Microbial Ecology. Other publications associated to the datasets are : (1) Reichel R., H\u00e4nsch M., Br\u00fcggemann N. (2017). Indication of rapid soil food web recovery by nematode-derived indices in restored agricultural soil after open-cast lignite mining. Soil Biology and Biochemistry, 115, 261-264. DOI: 10.1016/j.soilbio.2017.08.020; (2) Roy J., Reichel R., Br\u00fcggemann N., Hempel S., Rillig M. (2017). Succession of arbuscular mycorrhizal fungi along a 52-years agricultural recultivation chronosequence. FEMS Microbiology Ecology. DOI: 1093/femsec/fix102", "formats": [{"name": "CSV"}], "keywords": ["Soil", "agriculture", "microbiology", "opendata", "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic", "Boden", "agriculture", "microbiology"], "contacts": [{"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "BonaRes Data Center", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Matthias Rillig", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "rrillig@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3541-7853", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Forschungszentrum J\u00fclich GmbH;Freie Universit\u00e4t Berlin", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4cf3c473-96a6-4660-b973-30c0f03c7cd2", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure1.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure2.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure3.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "name": "item", "description": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4cf3c473-96a6-4660-b973-30c0f03c7cd2"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-04-15T00:00:00Z"}}, {"id": "bddcad29-92ec-40a9-9b90-5deb3ffe7b2d", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[13.47, 53.29], [13.47, 53.43], [13.86, 53.43], [13.86, 53.29], [13.47, 53.29]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "kettle holes"}, {"id": "plants"}, {"id": "water levels"}, {"id": "vegetation"}, {"id": "dynamics"}, {"id": "climate change"}, {"id": "plant succession"}, {"id": "unmanned aerial vehicles"}, {"id": "unmanned aerial vehicles"}, {"id": "water levels"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "Lebensr\u00e4ume und Biotope"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}, {"concepts": [{"id": "opendata"}, {"id": "macrophytes"}], "scheme": "individual"}, {"concepts": [{"id": "Germany"}, {"id": "Brandenburg"}, {"id": "Uckermark"}, {"id": "Quillow"}], "scheme": "Individual"}], "rights": "Reports, articles, papers, scientific and non-scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data re-used from the BonaRes Data Centre www.bonares.de. This data were created as part of ZALF research activities\". Although every care has been taken in preparing and testing the data, ZALF and BonaRes Data Centre cannot guarantee that the data are correct; neither does ZALF and BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The ZALF and Data Centre will not be responsible for any direct or indirect use which might be made of the data. If access to actual data is requested, please contact the data owner/author because these underlay an embargo.", "updated": "2023-08-16", "type": "Dataset", "created": "2021-03-05", "language": "eng", "title": "Coverage of dominant plant taxa, water surface area and hydrogeomorphological information for kettle holes surveyed in 2016, 2018 and 2020.", "description": "The published Excel tables contain coverage data from dominant plant communities (response variables) as well as from environmental variables (explanatory variables) collected at kettle holes.\nThe dominant plant communities and their coverage were determined on the basis of UAS images in summer 2016, 2018 and 2020. The delimitation of homogeneous vegetation from the surrounding vegetation areas, the water or the soil was done manually using the color, texture and/or shape in the UAS images. In the end there were 14 dominant plant communities. \nThe environmental variables include the kettle hole and the water surface area, which were determined every year based on the same UAS images as dominant plant communities. In addition, we publish the hydrogeomorphological types of the examined kettle holes and the class of the shore slope, both variables  included as dummy variables.", "formats": [{"name": "CSV"}], "keywords": ["kettle holes", "plants", "water levels", "vegetation", "dynamics", "climate change", "plant succession", "unmanned aerial vehicles", "unmanned aerial vehicles", "water levels", "Lebensr\u00e4ume und Biotope", "opendata", "macrophytes", "Germany", "Brandenburg", "Uckermark", "Quillow"], "contacts": [{"name": "Paetzig, Marlene", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": null, "roles": ["author"], "phones": [{"value": "+49 33432 82-470"}], "emails": [{"value": "marlene.paetzig@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Str.84"], "city": "M\u00fcncheberg", "administrativeArea": "15374", "postalCode": "15374", "country": "Germany"}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "orcid:0000-0003-1687-6982", "name_url": "", "description": "orcid", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Henning, Dorith", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": null, "roles": ["dataCollector"], "phones": [{"value": "+49 33432 82 332"}], "emails": [{"value": "henning@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Str.84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "D\u00fcker, Eveline", "organization": "unknown", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "unknown"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": null}]}, {"name": "Kalettka, Thomas", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": null, "roles": ["dataCollector"], "phones": [{"value": "+49 (0)33432 82-361"}], "emails": [{"value": "tkalettka@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Str. 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - WG Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "P\u00e4tzig, Marlene", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": null, "roles": ["pointOfContact"], "phones": [{"value": "+49 33432 82-470"}], "emails": [{"value": "marlene.paetzig@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Str. 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandeburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "orcid:0000-0003-1687-6982", "name_url": "", "description": "Orcid", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "P\u00e4tzig, Marlene", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": null, "roles": ["projectLeader"], "phones": [{"value": "+49 33432 82-470"}], "emails": [{"value": "marlene.paetzig@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Str. 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandeburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "orcid:0000-0003-1687-6982", "name_url": "", "description": "Orcid", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=bddcad29-92ec-40a9-9b90-5deb3ffe7b2d", "rel": "information"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/P\u00e4tzing_M..png", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "bddcad29-92ec-40a9-9b90-5deb3ffe7b2d", "name": "item", "description": "bddcad29-92ec-40a9-9b90-5deb3ffe7b2d", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/bddcad29-92ec-40a9-9b90-5deb3ffe7b2d"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"interval": ["2016-07-15T00:00:00Z", "2021-08-01T00:00:00Z"]}}], "links": [{"rel": "self", "type": "application/geo+json", "title": "This document as GeoJSON", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=SUCCESSION&f=json", "hreflang": "en-US"}, {"rel": "alternate", "type": "text/html", "title": "This document as HTML", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=SUCCESSION&f=html", "hreflang": "en-US"}, {"rel": "collection", "type": "application/json", "title": "Collection URL", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main", "hreflang": "en-US"}, {"type": "application/geo+json", "rel": "first", "title": "items (first)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=SUCCESSION&", "hreflang": "en-US"}, {"rel": "last", "type": "application/geo+json", "title": "items (last)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=SUCCESSION&offset=44", "hreflang": "en-US"}], "numberMatched": 44, "numberReturned": 44, "distributedFeatures": [], "timeStamp": "2026-07-28T12:53:43.130649Z"}