{"type": "FeatureCollection", "features": [{"id": "10141/623078", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:10Z", "type": "Journal Article", "created": "2022-11-12", "title": "Frontiers in soil ecology\u2014Insights from the World Biodiversity Forum 2022", "description": "Abstract<p>Global change is affecting soil biodiversity and functioning across all terrestrial ecosystems. Still, much is unknown about how soil biodiversity and function will change in the future in response to simultaneous alterations in climate and land use, as well as other environmental drivers. It is crucial to understand the direct, indirect\uffc2\uffa0and interactive effects of global change drivers on soil communities and ecosystems across environmental contexts, not only today but also in the near future. This is particularly relevant for international efforts to tackle climate change like the Paris Agreement, and considering the failure to achieve the 2020 biodiversity targets, especially the target of halting soil degradation. Here, we outline the main frontiers related to soil ecology that were presented and discussed at the thematic sessions of the World Biodiversity Forum 2022 in Davos, Switzerland. We highlight multiple frontiers of knowledge associated with data integration, causal inference, soil biodiversity and function scenarios, critical soil biodiversity facets, underrepresented drivers, global collaboration, knowledge application and transdisciplinarity, as well as policy and public communication. These identified research priorities are not only of immediate interest to the scientific community but may also be considered in research priority programmes and calls for funding.</p", "keywords": ["[SDE] Environmental Sciences", "0301 basic medicine", "570", "Agriculture (General)", "577", "soil biodiversity", "scenario modelling", "580 Plants (Botany)", "S1-972", "03 medical and health sciences", "10126 Department of Plant and Microbial Biology", "11. Sustainability", "Life Science", "GE1-350", "10211 Zurich-Basel Plant Science Center", "Biology", "soil macroecology", "Biodiversity change", "2. Zero hunger", "Soil macroecology", "0303 health sciences", "15. Life on land", "Scenario modelling", "Soil biodiversity", "6. Clean water", "Environmental sciences", "biodiversity change", "13. Climate action", "ecosystem functioning", "[SDE]Environmental Sciences", "Ecosystem functioning", "ta1181"]}, "links": [{"href": "https://onlinelibrary.wiley.com/doi/pdf/10.1002/sae2.12031"}, {"href": "https://doi.org/10141/623078"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Journal%20of%20Sustainable%20Agriculture%20and%20Environment", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10141/623078", "name": "item", "description": "10141/623078", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10141/623078"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-11T00:00:00Z"}}, {"id": "10.5281/zenodo.6921426", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:21:19Z", "type": "Report", "title": "Increase of soil biodiversity through amendment of forest based organic material in potato crops", "description": "Increase of soil biodiversity through amendment of forest based organic material in potato crops This work was funded by the European Commission Horizon 2020 project SoildiverAgro [grant agreement 817819].", "keywords": ["2. Zero hunger", "Soil Biodiversity", "Potato crops", "15. Life on land"], "contacts": [{"organization": "Peltoniemi, Krista", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5281/zenodo.6921426"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.6921426", "name": "item", "description": "10.5281/zenodo.6921426", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.6921426"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-01-01T00:00:00Z"}}, {"id": "10.5281/zenodo.6921427", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:21:19Z", "type": "Report", "title": "Increase of soil biodiversity through amendment of forest based organic material in potato crops", "description": "Increase of soil biodiversity through amendment of forest based organic material in potato crops This work was funded by the European Commission Horizon 2020 project SoildiverAgro [grant agreement 817819].", "keywords": ["2. Zero hunger", "Soil Biodiversity", "Potato crops", "15. Life on land"], "contacts": [{"organization": "Peltoniemi, Krista", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/10.5281/zenodo.6921427"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.6921427", "name": "item", "description": "10.5281/zenodo.6921427", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.6921427"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-01-01T00:00:00Z"}}, {"id": "10.5281/zenodo.7041394", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:21:20Z", "type": "Other", "title": "QBS-ar and QBS-ar_BF index toolbox for biodiversity assessment of microarthropods community in soil", "description": "This toolbox contains a proposal and detailed instructions for the standardization of the QBS-ar index procedure. The QBS-ar index (Parisi, 2001; Parisi et al., 2005) is an index aimed at assessing soil-dwelling microarthropod communities in relation to their soil adaptation. The core of QBS-ar index principle is: the higher is soil quality, the higher will be the number of microarthropod groups well adapted to soil habitats living there. Soil quality here stands for good stability, high organic matter content, and good biodiversity level. Worth of notice, QBS-ar is not comprehensive of the whole soil biodiversity or whole soil quality. For each sample to be assessed with the QBS-ar method, three different samplings are performed 5-10 meters apart (Menta et al., 2018), obtaining three subsamples that are considered representative of an area homogeneous for slope and vegetation. 1-page guidelines for sampling and extraction were detailed in file <strong>\u20181.QBS-ar sampling and extraction guidelines.pdf\u2019</strong>. The functional characteristics for soil adaptation of microarthropods are the reduction of visual structures as microphthalmia or even anophthalmia, the reduction or loss of pigmentation and dehydration adaptations (thinner cuticle, shorter setas or chaeta loss), appendage reduction (as shorter and/or smaller antennae, legs, furca), miniaturization, streamlined body form. Starting from these principles, soil organisms could be divided into a discrete set of Biological Forms (BFs, eco-morpho-types) according to their morphological adaptation to soil (Menta et al., 2018); in the EXCALIBUR and EJP-Minotaur projects, CREA Research Centre for Agriculture and Environment, in collaboration with the National QBS-ar working group (D\u2019Avino et al., 2021), recognized no less than 54 different BFs, 16 of which were classified as less frequent. Each BF is shortly described and associated with a score, the so-called Eco-Morphological Index (EMI), which ranges from 1 to 20 in proportion to the increasing degree of the soil adaptation of microarthropods. As reported by Parisi et al. (2005), some taxa show only one single EMI value because all species belonging to these taxa report the same adaptation level to the soil. Other groups show a range of EMIs in relation to the different adaptation levels of species to the soil. In general, eu-edaphic forms get EMI = 20, hemi-edaphic get an EMI rating proportionate to their degree of soil adaptation, while epedaphic (epigean) forms get EMI score = 1 (Menta et al., 2018). In QBS-ar whenever two eco-morphological forms are present in the same group, the final score is determined by the higher EMI. In other words, the most highly adapted microarthropods belonging to a group determine the overall EMI score for that group (Parisi et al 2005). This statement is not valid for the QBS-ar_BF proposed here, for which every biological form concurs to the calculation of QBS-ar_BF index, regardless of whether or not it belongs to the same group (i.e. class or order). Moreover, to assess variability between subsamples an index based on spectral analysis (D\u2019Avino, 2019) is proposed. The file <strong>\u20182.Sheet for QBS-ar record and calculation_v2.xlsx\u2019</strong> provides the selection of 54 most common BFs in European soils and should be used as a template for data registration during the microarthropods identification and count at the stereomicroscope. As outlined in the \u201cREADME\u201d sheet of the excel file, the user should register the abundance of each BF and other sampling-related information, and the template will automatically perform a series of calculations and will format several output sheets. In particular it calculates: mean abundance of microarthropods and relative class of abundance, QBS-ar, QBS-ar_BF, variability index community based on spectral analysis. One example of the compilated sheet is reported as file <strong>\u20182a.Filled_template_example_v2.pdf\u2019</strong>. The sampling was carried out during MINOTAUR project, the example was implemented starting from file <strong>\u20182. Sheet for QBS-ar record and calculation.xlsx\u2019</strong>. The collection, merging and organization of data from the precompiled sheet could be a cumbersome task, especially for surveys with many different samples. The user would need to copy-paste each row in the \u201cExport_Sample\u201d or \u201cExport_Subsample\u201d sheets (from file 2.) to a new file, to perform overall analysis; an error-prone operation. To ease this process, we have compiled a short R script that can be found in this submission as the third file <strong>\u20183.QBS-ar data merging_v2.R\u2019</strong>. By using the script, the user would automatically obtain three files (csv and/or xlsx, that will be stored in a \u201cResults\u201d folder) resulting from the merging of any number of QBS precompiled templates collected in a folder: 1. The result of the merge of \u201cExport_Sample\u201d sheets 2. The result of the merge of \u201cExport_Subsample\u201d sheets 3. The result of the merge of 'Export_MINOTAUR' sheets Cited reference D\u2019Avino, L., Menta, C., Jacomini, C., Cassi, F., L\u2019Abate, G., La Terza, A., Staffilani, F., Pocaterra, F., Piazzi, M., Parisi, V. (2021). The Italian skill network of Soil Biological Quality assessed by microarthropods\u2019 community, in: FAO. 2021. Keep soil alive, protect soil biodiversity \u2013Global Symposium on Soil Biodiversity 19\u201322 April 2021. Proceedings. Rome. ISBN [978-92-5-135218-2] pages 182-188. Available at https://doi.org/10.4060/cb7374en (accessed 01/09/2022) D\u2019Avino 2019. Soil mesofauna QBS-ar index in: Malusa et al. Common guidelines for analytical methods. https://cordis.europa.eu/project/id/817946/results/it (Accessed 28/03/2023) Menta, C., Conti, F. D., Pinto, S., Bodini, A. (2018). Soil Biological Quality index (QBS-ar): 15 years of application at global scale. Ecological Indicators, 85, 773-780. Parisi V. (2001). La qualit\u00e0 biologica del suolo. Un metodo basato sui microartropodi [In Italian] Acta Naturalia de L\u2019Ateneo Parmense 37, 97-106. Parisi, V., Menta, C., Gardi, C., Jacomini, C., Mozzanica, E. (2005). Microarthropod communities as a tool to assess soil quality and biodiversity: a new approach in Italy. Agriculture, Ecosystems &amp; Environment, 105 (12), 323-333.", "keywords": ["2. Zero hunger", "Data manipulation", "Mesofauna", "15. Life on land", "QBS data template", "Soil biodiversity", "Soil quality"]}, "links": [{"href": "https://doi.org/10.5281/zenodo.7041394"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.7041394", "name": "item", "description": "10.5281/zenodo.7041394", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.7041394"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-09-05T00:00:00Z"}}, {"id": "10.5281/zenodo.7778672", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:21:26Z", "type": "Other", "title": "QBS-ar and QBS-ar_BF index toolbox for biodiversity assessment of microarthropods community in soil", "description": "This toolbox contains a proposal and detailed instructions for the standardization of the QBS-ar index procedure. The QBS-ar index (Parisi, 2001; Parisi et al., 2005) is an index aimed at assessing soil-dwelling microarthropod communities in relation to their soil adaptation. The core of QBS-ar index principle is: the higher is soil quality, the higher will be the number of microarthropod groups well adapted to soil habitats living there. Soil quality here stands for good stability, high organic matter content, and good biodiversity level. Worth of notice, QBS-ar is not comprehensive of the whole soil biodiversity or whole soil quality. For each sample to be assessed with the QBS-ar method, three different samplings are performed 5-10 meters apart (Menta et al., 2018), obtaining three subsamples that are considered representative of an area homogeneous for slope and vegetation. 1-page guidelines for sampling and extraction were detailed in file <strong>\u20181.QBS-ar sampling and extraction guidelines.pdf\u2019</strong>. The functional characteristics for soil adaptation of microarthropods are the reduction of visual structures as microphthalmia or even anophthalmia, the reduction or loss of pigmentation and dehydration adaptations (thinner cuticle, shorter setas or chaeta loss), appendage reduction (as shorter and/or smaller antennae, legs, furca), miniaturization, streamlined body form. Starting from these principles, soil organisms could be divided into a discrete set of Biological Forms (BFs, eco-morpho-types) according to their morphological adaptation to soil (Menta et al., 2018); in the EXCALIBUR and EJP-Minotaur projects, CREA Research Centre for Agriculture and Environment, in collaboration with the National QBS-ar working group (D\u2019Avino et al., 2021), recognized no less than 54 different BFs, 16 of which were classified as less frequent. Each BF is shortly described and associated with a score, the so-called Eco-Morphological Index (EMI), which ranges from 1 to 20 in proportion to the increasing degree of the soil adaptation of microarthropods. As reported by Parisi et al. (2005), some taxa show only one single EMI value because all species belonging to these taxa report the same adaptation level to the soil. Other groups show a range of EMIs in relation to the different adaptation levels of species to the soil. In general, eu-edaphic forms get EMI = 20, hemi-edaphic get an EMI rating proportionate to their degree of soil adaptation, while epedaphic (epigean) forms get EMI score = 1 (Menta et al., 2018). In QBS-ar whenever two eco-morphological forms are present in the same group, the final score is determined by the higher EMI. In other words, the most highly adapted microarthropods belonging to a group determine the overall EMI score for that group (Parisi et al 2005). This statement is not valid for the QBS-ar_BF proposed here, for which every biological form concurs to the calculation of QBS-ar_BF index, regardless of whether or not it belongs to the same group (i.e. class or order). Moreover, to assess variability between subsamples an index based on spectral analysis (D\u2019Avino, 2019) is proposed. The file <strong>\u20182.Sheet for QBS-ar record and calculation_v2.xlsx\u2019</strong> provides the selection of 54 most common BFs in European soils and should be used as a template for data registration during the microarthropods identification and count at the stereomicroscope. As outlined in the \u201cREADME\u201d sheet of the excel file, the user should register the abundance of each BF and other sampling-related information, and the template will automatically perform a series of calculations and will format several output sheets. In particular it calculates: mean abundance of microarthropods and relative class of abundance, QBS-ar, QBS-ar_BF, variability index community based on spectral analysis. One example of the compilated sheet is reported as file <strong>\u20182a.Filled_template_example_v2.pdf\u2019</strong>. The sampling was carried out during MINOTAUR project, the example was implemented starting from file <strong>\u20182. Sheet for QBS-ar record and calculation.xlsx\u2019</strong>. The collection, merging and organization of data from the precompiled sheet could be a cumbersome task, especially for surveys with many different samples. The user would need to copy-paste each row in the \u201cExport_Sample\u201d or \u201cExport_Subsample\u201d sheets (from file 2.) to a new file, to perform overall analysis; an error-prone operation. To ease this process, we have compiled a short R script that can be found in this submission as the third file <strong>\u20183.QBS-ar data merging_v2.R\u2019</strong>. By using the script, the user would automatically obtain three files (csv and/or xlsx, that will be stored in a \u201cResults\u201d folder) resulting from the merging of any number of QBS precompiled templates collected in a folder: 1. The result of the merge of \u201cExport_Sample\u201d sheets 2. The result of the merge of \u201cExport_Subsample\u201d sheets 3. The result of the merge of 'Export_MINOTAUR' sheets Cited reference D\u2019Avino, L., Menta, C., Jacomini, C., Cassi, F., L\u2019Abate, G., La Terza, A., Staffilani, F., Pocaterra, F., Piazzi, M., Parisi, V. (2021). The Italian skill network of Soil Biological Quality assessed by microarthropods\u2019 community, in: FAO. 2021. Keep soil alive, protect soil biodiversity \u2013Global Symposium on Soil Biodiversity 19\u201322 April 2021. Proceedings. Rome. ISBN [978-92-5-135218-2] pages 182-188. Available at https://doi.org/10.4060/cb7374en (accessed 01/09/2022) D\u2019Avino 2019. Soil mesofauna QBS-ar index in: Malusa et al. Common guidelines for analytical methods. https://cordis.europa.eu/project/id/817946/results/it (Accessed 28/03/2023) Menta, C., Conti, F. D., Pinto, S., Bodini, A. (2018). Soil Biological Quality index (QBS-ar): 15 years of application at global scale. Ecological Indicators, 85, 773-780. Parisi V. (2001). La qualit\u00e0 biologica del suolo. Un metodo basato sui microartropodi [In Italian] Acta Naturalia de L\u2019Ateneo Parmense 37, 97-106. Parisi, V., Menta, C., Gardi, C., Jacomini, C., Mozzanica, E. (2005). Microarthropod communities as a tool to assess soil quality and biodiversity: a new approach in Italy. Agriculture, Ecosystems &amp; Environment, 105 (12), 323-333.", "keywords": ["2. Zero hunger", "Data manipulation", "Mesofauna", "15. Life on land", "QBS data template", "Soil biodiversity", "Soil quality"]}, "links": [{"href": "https://doi.org/10.5281/zenodo.7778672"}, {"rel": "self", "type": "application/geo+json", "title": "10.5281/zenodo.7778672", "name": "item", "description": "10.5281/zenodo.7778672", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10.5281/zenodo.7778672"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-09-05T00:00:00Z"}}, {"id": "10029/623539", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:07Z", "type": "Journal Article", "created": "2019-06-12", "title": "Mapping Soil Biodiversity in Europe and the Netherlands", "description": "<?xml version='1.0' encoding='UTF-8'?><article><p>Soil is fundamental for the functioning of terrestrial ecosystems, but our knowledge about soil organisms and the habitat they provide (shortly: Soil biodiversity) is poorly developed. For instance, the European Atlas of Soil Biodiversity and the Global Soil Biodiversity Atlas contain maps with rather coarse information on soil biodiversity. This paper presents a methodology to map soil biodiversity with limited data and models. Two issues were addressed. First, the lack of consensus to quantify the soil biodiversity function and second, the limited data to represent large areas. For the later issue, we applied a digital soil mapping (DSM) approach at the scale of the Netherlands and Europe. Data of five groups of soil organisms (earthworms, enchytraeids, micro-arthropods, nematodes, and micro-organisms) in the Netherlands were linked to soil habitat predictors (chemical soil attributes) in a regression analysis. High-resolution maps with soil characteristics were then used together with a model for the soil biodiversity function with equal weights for each group of organisms. To predict soil biodiversity at the scale of Europe, data for soil biological (earthworms and bacteria) and chemical (pH, soil organic matter, and nutrient content) attributes were used in a soil biodiversity model. Differential weights were assigned to the soil attributes after consulting a group of scientists. The issue of reducing uncertainty in soil biodiversity modelling and mapping by the use of data from biological soil attributes is discussed. Considering the importance of soil biodiversity to support the delivery of ecosystem services, the ability to create maps illustrating an aggregate measure of soil biodiversity is a key to future environmental policymaking, optimizing land use, and land management decision support taking into account the loss and gains on soil biodiversity.</p></article>", "keywords": ["2. Zero hunger", "Physical geography", "Soil multi-functionality", "soil biodiversity", "04 agricultural and veterinary sciences", "soil functions", "15. Life on land", "Soil functions", "Soil biodiversity", "GB3-5030", "Chemistry", "Digital soil mapping", "13. Climate action", "soil multi-functionality", "digital soil mapping", "Ecosystem services", "0401 agriculture", " forestry", " and fisheries", "ecosystem services", "Biology", "QD1-999"]}, "links": [{"href": "http://www.mdpi.com/2571-8789/3/2/39/pdf"}, {"href": "https://www.mdpi.com/2571-8789/3/2/39/pdf"}, {"href": "https://doi.org/10029/623539"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Systems", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10029/623539", "name": "item", "description": "10029/623539", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10029/623539"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2019-06-12T00:00:00Z"}}, {"id": "10044/1/101414", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:07Z", "type": "Journal Article", "created": "2022-11-17", "title": "Land use and soil characteristics affect soil organisms differently from above-ground assemblages", "description": "Abstract                 Background                 <p>Land-use is a major driver of changes in biodiversity worldwide, but studies have overwhelmingly focused on above-ground taxa: the effects on soil biodiversity are less well known, despite the importance of soil organisms in ecosystem functioning. We modelled data from a global biodiversity database to compare how the abundance of soil-dwelling and above-ground organisms responded to land use and soil properties.</p>                                Results                 <p>We found that land use affects overall abundance differently in soil and above-ground assemblages. The abundance of soil organisms was markedly lower in cropland and plantation habitats than in primary vegetation and pasture. Soil properties influenced the abundance of soil biota in ways that differed among land uses, suggesting they shape both abundance and its response to land use.</p>                                Conclusions                 <p>Our results caution against assuming models or indicators derived from above-ground data can apply to soil assemblages and highlight the potential value of incorporating soil properties into biodiversity models.</p>", "keywords": ["Land-use intensity", "0106 biological sciences", "570", "Evolution", "[SDV]Life Sciences [q-bio]", "Organism abundance", "soil biodiversity", "01 natural sciences", "soil biota", "mixed-effects models", "Soil", "land\u2011use intensity", "Land-use", " Land-use intensity", " Mixed-effects models", " Organism abundance", " Soil biodiversity", " Soil biota", "land-use", "QH359-425", "Soil biota", "land-use intensity", "Biology", "Land-use", "QH540-549.5", "Ecosystem", "Soil Microbiology", "2. Zero hunger", "Ecology", "Research", "Biology and Life Sciences", "Biodiversity", "04 agricultural and veterinary sciences", "15. Life on land", "organism abundance", "Soil biodiversity", "Biota", "ddc:", "[SDV] Life Sciences [q-bio]", "Chemistry", "land\u2011use", "13. Climate action", "0401 agriculture", " forestry", " and fisheries", "Human medicine", "Mixed-effects models", "mixed\u2011effects models"]}, "links": [{"href": "https://www.iris.unict.it/bitstream/20.500.11769/647835/1/12862_2022_Article_2089.pdf"}, {"href": "https://link.springer.com/content/pdf/10.1186/s12862-022-02089-4.pdf"}, {"href": "https://doi.org/10044/1/101414"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/BMC%20Ecology%20and%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10044/1/101414", "name": "item", "description": "10044/1/101414", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10044/1/101414"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-17T00:00:00Z"}}, {"id": "10138/576497", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:09Z", "type": "Journal Article", "title": "Soil BON Earthworm - A global initiative on earthworm distribution, traits, and spatiotemporal diversity patterns", "description": "Open AccessPeer reviewed", "keywords": ["2. Zero hunger", "temporal dynamics", "500", "soil biodiversity", "earthworms", "time-series data", "15. Life on land", "Traits", "Microbiology", "630", "QR1-502", "[SDE.BE] Environmental Sciences/Biodiversity and Ecology", "QL1-991", "Ecology", " evolutionary biology", "global collaboration", "ecosystem functioning", "citizen science", "Community ecology", "functional traits", "14. Life underwater", "[SDE.BE]Environmental Sciences/Biodiversity and Ecology", "Zoology", "community ecology"]}, "links": [{"href": "https://doi.org/10138/576497"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Organisms", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10138/576497", "name": "item", "description": "10138/576497", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10138/576497"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-01-01T00:00:00Z"}}, {"id": "10138/584713", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:09Z", "type": "Journal Article", "title": "Communicating soil biodiversity research to kids around the world", "description": "Open AccessPeer reviewed", "keywords": ["[SDE] Environmental Sciences", "young adults", "2. Zero hunger", "570", "education", "4. Education", "translation", "online resource", "soil biodiversity", "Media and communications", "15. Life on land", "science communication", "Microbiology", "333", "teaching", "QR1-502", "children", "QL1-991", "Ecology", " evolutionary biology", "13. Climate action", "[SDE]Environmental Sciences", "11. Sustainability", "Zoology"]}, "links": [{"href": "https://doi.org/10138/584713"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Organisms", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "10138/584713", "name": "item", "description": "10138/584713", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/10138/584713"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-01-01T00:00:00Z"}}, {"id": "1959.7/uws:47825", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:37Z", "type": "Journal Article", "created": "2018-05-19", "title": "Experimentally testing the species-habitat size relationship on soil bacteria: A proof of concept", "description": "Abstract   The species-area relationship is one of the most widely reported ecological theories accounting for biodiversity of plants and animals. However, we lack solid experimental data demonstrating whether this key ecological theorem also applies in the microbial world. Here, we conducted a microcosm study to evaluate the role of habitat area in driving the diversity, abundance, composition and functioning (i.e., four enzyme activities linked to organic matter decomposition) of soil bacterial communities. Thus, we aim to evaluate whether the principle of species-area relationship is potentially applicable to soil microbes. We established a fully factorial experimental design of three island sizes (\u223c9, 50 and 150\u202fcm2) by two sterile soils (low, high resources). After six months of glasshouse incubation, habitat-area was positively related to bacterial richness, relative abundance of Chloroflexi, Verrucomicrobia and \u03b4-proteobacteria, and soil functions in both soils. Soil with higher resources always had the greatest bacterial richness and functions. Our findings provide a proof of concept by demonstrating the potential importance of both habitat-area and resource availability in driving soil bacterial biodiversity and functioning.", "keywords": ["2. Zero hunger", "habitat (ecology)", "XXXXXX - Unknown", "soil biodiversity", "15. Life on land", "biodegradation", "soil microbiology"]}, "links": [{"href": "https://doi.org/1959.7/uws:47825"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil%20Biology%20and%20Biochemistry", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "1959.7/uws:47825", "name": "item", "description": "1959.7/uws:47825", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/1959.7/uws:47825"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2018-08-01T00:00:00Z"}}, {"id": "1959.7/uws:73410", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:38Z", "type": "Journal Article", "created": "2023-05-11", "title": "Water availability creates global thresholds in multidimensional soil biodiversity and functions", "description": "Soils support an immense portion of Earth's biodiversity and maintain multiple ecosystem functions which are essential for human well-being. Environmental thresholds are known to govern global vegetation patterns, but it is still unknown whether they can be used to predict the distribution of soil organisms and functions across global biomes. Using a global field survey of 383 sites across contrasting climatic and vegetation conditions, here we showed that soil biodiversity and functions exhibited pervasive nonlinear patterns worldwide and are mainly governed by water availability (precipitation and potential evapotranspiration). Changes in water availability resulted in drastic shifts in soil biodiversity (bacteria, fungi, protists and invertebrates) and soil functions including plant-microbe interactions, plant productivity, soil biogeochemical cycles and soil carbon sequestration. Our findings highlight that crossing specific water availability thresholds can have critical consequences for the provision of essential ecosystem services needed to sustain our planet.", "keywords": ["2. Zero hunger", "Ecolog\u00eda (Biolog\u00eda)", "2505.01 Biogeograf\u00eda", "Medio ambiente natural", "Water availability", "2417.13 Ecolog\u00eda Vegetal", "2417.90 Fijaci\u00f3n y Movilizaci\u00f3n Biol\u00f3gica de Nutrientes", "Water", "Edafolog\u00eda (Biolog\u00eda)", "Biodiversity", "15. Life on land", "Soil functions", "574", "Soil biodiversity", "Invertebrates", "6. Clean water", "631.4", "Soil", "13. Climate action", "XXXXXX - Unknown", "Animals", "Humans", "Thresholds", "502.5", "Ecosystem"]}, "links": [{"href": "https://www.nature.com/articles/s41559-023-02071-3.pdf"}, {"href": "https://doi.org/1959.7/uws:73410"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Nature%20Ecology%20%26amp%3B%20Evolution", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "1959.7/uws:73410", "name": "item", "description": "1959.7/uws:73410", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/1959.7/uws:73410"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2023-05-11T00:00:00Z"}}, {"id": "20.500.14243/469825", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:47Z", "type": "Journal Article", "created": "2024-03-14", "title": "Participatory soil citizen science: An unexploited resource for European soil research", "description": "Abstract                   <p>Soils are key components of our ecosystems and provide 95%\uffe2\uff80\uff9399% of our food. This importance is reflected by an increase in participatory citizen science projects on soils. Citizen science is a participatory research method that actively involves and engages the public in scientific enquiry to generate new knowledge or understanding. Here, we review past and current citizen science projects on agricultural soils across Europe. We conducted a web\uffe2\uff80\uff90based survey and described 24 reviewed European citizen science projects in the light of the 10 principles of citizen science and identified success factors for citizen science. Over 66% of the projects generated soil biodiversity data; 54% and 42% of the projects generated data on vegetation cover and soil organic carbon, respectively. Our findings show that soil citizen science projects aligned with the 10 principles of citizen science offer an unexploited resource for European soil health research. We conclude that promoting co\uffe2\uff80\uff90creation, fostering knowledge\uffe2\uff80\uff90sharing networks and enabling long\uffe2\uff80\uff90term communication and commitment with citizens are success factors for further development of citizen science on soils.</p", "keywords": ["0301 basic medicine", "2. Zero hunger", "570", "web-based survey", "soil health", "soil biodiversity", "[SDV.SA.SDS]Life Sciences [q-bio]/Agricultural sciences/Soil study", "15. Life on land", "01 natural sciences", "333", "12. Responsible consumption", "03 medical and health sciences", "13. Climate action", "EJPSOIL", "EJPSOIL", " European agroecosystems", " participatory research", " soil biodiversity", " soil health", " web-based survey", "11. Sustainability", "European agroecosystems", "participatory research", "[SDV.SA.SDS] Life Sciences [q-bio]/Agricultural sciences/Soil study", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://iris.cnr.it/bitstream/20.500.14243/469825/1/2024_European%20J%20Soil%20Scienc_Mason.pdf"}, {"href": "https://doi.org/20.500.14243/469825"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/European%20Journal%20of%20Soil%20Science", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "20.500.14243/469825", "name": "item", "description": "20.500.14243/469825", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/20.500.14243/469825"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-03-01T00:00:00Z"}}, {"id": "2440/106807", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:22:57Z", "type": "Journal Article", "created": "2017-06-13", "title": "Circular linkages between soil biodiversity, fertility and plant productivity are limited to topsoil at the continental scale", "description": "Summary<p>   <p>The current theoretical framework suggests that tripartite positive feedback relationships between soil biodiversity, fertility and plant productivity are universal. However, empirical evidence for these relationships at the continental scale and across different soil depths is lacking.</p>  <p>We investigate the continental\uffe2\uff80\uff90scale relationships between the diversity of microbial and invertebrate\uffe2\uff80\uff90based soil food webs, fertility and above\uffe2\uff80\uff90ground plant productivity at 289 sites and two soil depths, that is 0\uffe2\uff80\uff9310 and 20\uffe2\uff80\uff9330\uffc2\uffa0cm, across Australia.</p>  <p>Soil biodiversity, fertility and plant productivity are strongly positively related in surface soils. Conversely, in the deeper soil layer, the relationships between soil biodiversity, fertility and plant productivity weaken considerably, probably as a result of a reduction in biodiversity and fertility with depth. Further modeling suggested that strong positive associations among soil biodiversity\uffe2\uff80\uff93fertility and fertility\uffe2\uff80\uff93plant productivity are limited to the upper soil layer (0\uffe2\uff80\uff9310\uffc2\uffa0cm), after accounting for key factors, such as distance from the equator, altitude, climate and physicochemical soil properties.</p>  <p>These findings highlight the importance of surface soil biodiversity for soil fertility, and suggest that any loss of surface soil could potentially break the links between soil biodiversity\uffe2\uff80\uff93fertility and/or fertility\uffe2\uff80\uff93plant productivity, which can negatively impact nutrient cycling and food production, upon which future generations depend.</p>  </p", "keywords": ["0301 basic medicine", "Eukaryotes", "Climate", "Plant Development", "soil biodiversity", "Terrestrial ecosystems", "Soil", "03 medical and health sciences", "eukaryotes", "1110 Plant Science", "XXXXXX - Unknown", "plant productivity", "bacteria", "Ecosystem functionality", "Soil Microbiology", "2. Zero hunger", "0303 health sciences", "Bacteria", "Australia", "terrestrial ecosystems", "1314 Physiology", "Biodiversity", "15. Life on land", "Soil biodiversity", "ecosystem functionality", "Fertility", "ecosystems", "Plant productivity"]}, "links": [{"href": "https://nph.onlinelibrary.wiley.com/doi/pdf/10.1111/nph.14634"}, {"href": "https://doi.org/2440/106807"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/New%20Phytologist", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "2440/106807", "name": "item", "description": "2440/106807", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/2440/106807"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2017-06-13T00:00:00Z"}}, {"id": "50|od______2659::d1a12d46a64afc4d963666aa6cd0c66b", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:23:43Z", "type": "Dataset", "title": "Database of soil vulnerability to natural forest disturbances", "description": "The data in this repository relate to evidence synthesis projects which aim to assess the impacts of different natural disturbances, such as fire and precipitation changes on forest soils. This work was carried out as part of the Holisoils project funded by EU Horizon 2020 program (EU Horizon 2020 Grant Agreement No 101000289).", "keywords": ["forest", "precipitation reductions", "windthrow", "precipitation increases", "natural disturbances", "soil biodiversity", "drought", "precipitation change", "insect pest", "fire"], "contacts": [{"organization": "Martin, Philip", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/50|od______2659::d1a12d46a64afc4d963666aa6cd0c66b"}, {"rel": "self", "type": "application/geo+json", "title": "50|od______2659::d1a12d46a64afc4d963666aa6cd0c66b", "name": "item", "description": "50|od______2659::d1a12d46a64afc4d963666aa6cd0c66b", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/50|od______2659::d1a12d46a64afc4d963666aa6cd0c66b"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-02-06T00:00:00Z"}}, {"id": "50|od______2659::ff8f611a920515dc2d31fbacee33e699", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:23:43Z", "type": "Other", "title": "Template to declare data and metadata on soil biodiversity", "description": "The template was developed within the EJP SOIL project Minotaur to upload relevant data and metadata on soil biodiversity. It was used to collect information across EU countries on soil biodiversity to be organized in an information system developed with the OpenAdom platform (see also https://zenodo.org/records/14245502).", "keywords": ["data", "metadata", "soil biodiversity"], "contacts": [{"organization": "Yayende, Vivianne, Adam, Mario, Aponte, Cristina, Assennato, Francesca, Bernard, Yannick, Bevivino, Annamaria, Bloem, Jaap, Bragato, Gilberto, Brennan, Fiona, Carteaux, Laurence, D'Avino, Lorenzo, Del Duca, Sara, Di Lonardo, Sara, Emily, Mathieu, Faber, Jack, Fantappi\u00e8, Maria, Fornasier, Flavio, Geneste, Christophe, Hamelin, Gaelle, Hedde, Mickael, Le Bas, Christine, Imbert, Camille, Jacomini, Carlo, L'Abate, Giovanni, Latini, Arianna, Lavazzo, Pietro, Lemercier, Blandine, LUMINI, Erica, Maienza, Anita, Manici, Luisa M., Mareckova, Marketa, Mittmannsgruber, Marion, Murugan, Rajasekaran, Mocali, Stefano, Pastorelli, Roberta, PERES, Gu\u00e9nola, Pichelin, Pascal, Postma, Joeke, Romero, Ferran, Roucaute, Marc, Schellenberger, Antoine, Stefanova, Milena, Suhadolc, Marjetka, Tcherniatinsky, Philippe, Tondini, Elena, van de Voorde, Tess, Vanderheijden, Marcel, Viketoft, Maria, Vitali, Francesco, Wall, David, Walter, Christian, Zaller, Johann, BISPO, Antonio,", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/50|od______2659::ff8f611a920515dc2d31fbacee33e699"}, {"rel": "self", "type": "application/geo+json", "title": "50|od______2659::ff8f611a920515dc2d31fbacee33e699", "name": "item", "description": "50|od______2659::ff8f611a920515dc2d31fbacee33e699", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/50|od______2659::ff8f611a920515dc2d31fbacee33e699"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-11-30T00:00:00Z"}}, {"id": "Biol\u00f3giai-talaj\u00e1llapot", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[16.2, 45.76], [16.2, 48.62], [22.71, 48.62], [22.71, 45.76], [16.2, 45.76]]]}, "properties": {"themes": [{"concepts": [{"id": "geoscientificInformation"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "National"}], "scheme": "https://inspire.ec.europa.eu/metadata-codelist/SpatialScope"}, {"concepts": [{"id": "MensMeu"}], "scheme": "Source"}, {"concepts": [{"id": "Hungary"}], "scheme": "http://publications.europa.eu/resource/authority/country"}, {"concepts": [{"id": "decline soil biodiversity"}], "scheme": "http://aims.fao.org/aos/agrovoc/c_330883"}], "license": "no conditions apply", "updated": "2012-01-01", "type": "Dataset", "created": "01-01-2012", "language": "hun", "title": "Biological soil status", "description": "Soil biological status:", "formats": [{"name": "text/html"}, {"name": "canonical"}], "keywords": ["soil type", "basic soil properties", "National", "MensMeu", "Hungary", "decline soil biodiversity"], "contacts": [{"name": "L\u00e1szl\u00f3 P\u00e1sztor", "organization": "Institute for Soil Sciences,", "position": null, "roles": ["pointOfContact"], "phones": [{"value": null}], "emails": [{"value": "pasztor@rissac.hu"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": "Hungary"}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": null, "name_url": "", "description": null, "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}]}, "links": [{"href": "http://okir-tdr.helion.hu/?talajallapot=1", "name": "HTML", "protocol": "text/html", "rel": null}, {"href": "https://github.com/ejpsoil/ejpsoildatahub/tree/main/datasets/mensmeu/Hungary/Biologiai-talajallapot.yml", "name": "Source of the record", "protocol": "canonical", "rel": "canonical"}, {"rel": "self", "type": "application/geo+json", "title": "Biol\u00f3giai-talaj\u00e1llapot", "name": "item", "description": "Biol\u00f3giai-talaj\u00e1llapot", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Biol\u00f3giai-talaj\u00e1llapot"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2012-01-01T00:00:00Z"}}, {"id": "PMC11734576", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:24:46Z", "type": "Journal Article", "created": "2024-11-26", "title": "Wheat field earthworms under divergent farming systems across a European climate gradient", "description": "Abstract<p>Earthworms are a key faunal group in agricultural soils, but little is known on how farming systems affect their communities across wide climatic gradients and how farming system choice might mediate earthworms' exposure to climate conditions. Here, we studied arable soil earthworm communities on wheat fields across a European climatic gradient, covering nine pedo\uffe2\uff80\uff90climatic zones, from Mediterranean to Boreal (S to N) and from Lusitanian to Pannonian (W to E). In each zone, 20\uffe2\uff80\uff9325 wheat fields under conventional or organic farming were sampled. Community metrics (total abundance, fresh mass, and species richness and composition) were combined with data on climate conditions, soil properties, and field management and analyzed with mixed models. There were no statistically discernible differences between organic and conventional farming for any of the community metrics. The effects of refined arable management factors were also not detected, except for an elevated proportion of subsurface\uffe2\uff80\uff90feeding earthworms when crop residues were incorporated. Soil properties were not significantly associated with earthworm community variations, which in the case of soil texture was likely due to low variation in the data. Pedo\uffe2\uff80\uff90climatic zone was an overridingly important factor in explaining the variation in community metrics. The Boreal zone had the highest mean total abundance (179\uffe2\uff80\uff89individuals\uffe2\uff80\uff89m\uffe2\uff88\uff922) and fresh mass (86\uffe2\uff80\uff89g\uffe2\uff80\uff89m\uffe2\uff88\uff922) of earthworms while the southernmost Mediterranean zones had the lowest metrics (&lt;1\uffe2\uff80\uff89individual\uffe2\uff80\uff89m\uffe2\uff88\uff922 and &lt;1\uffe2\uff80\uff89g\uffe2\uff80\uff89m\uffe2\uff88\uff922). Within each field, species richness was low across the zones, with the highest values being recorded at the Nemoral and North Atlantic zones (mean of 2\uffe2\uff80\uff933 species per field) and declining from there toward north and south. No litter\uffe2\uff80\uff90dwelling species were found in the southernmost, Mediterranean zones. These regional trends were discernibly related to climate, with the community metrics declining with the increasing mean annual temperature. The current continent\uffe2\uff80\uff90wide warming of Europe and related increase of severe and rapid onsetting droughts will likely deteriorate the living conditions of earthworms, particularly in southern Europe. The lack of interaction between the pedo\uffe2\uff80\uff90climatic zone and the farming system in our data for any of the earthworm community metrics may indicate limited opportunities for alleviating the negative effects of a warming climate in cereal field soils of Europe.</p", "keywords": ["arable fields", "Climate", "soil biodiversity", "Agriculture", "04 agricultural and veterinary sciences", "organicfarming", "global warming", "01 natural sciences", "630", "Article", "Europe", "Soil", "climate change", "macrofauna", "organic farming", "Animals", "0401 agriculture", " forestry", " and fisheries", "farming systems", "Oligochaeta", "regional distributions", "Triticum", "0105 earth and related environmental sciences"]}, "links": [{"href": "https://doi.org/PMC11734576"}, {"rel": "related", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Ecological%20Applications", "name": "related record", "description": "related record", "type": "application/json"}, {"rel": "self", "type": "application/geo+json", "title": "PMC11734576", "name": "item", "description": "PMC11734576", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/PMC11734576"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-11-25T00:00:00Z"}}, {"id": "Soil-and-Earthworm-Survey", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[-7.57, 49.96], [-7.57, 58.64], [1.68, 58.64], [1.68, 49.96], [-7.57, 49.96]]]}, "properties": {"themes": [{"concepts": [{"id": "geoscientificInformation"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "National"}], "scheme": "https://inspire.ec.europa.eu/metadata-codelist/SpatialScope"}, {"concepts": [{"id": "MensMeu"}], "scheme": "Source"}, {"concepts": [{"id": "UK"}], "scheme": "http://publications.europa.eu/resource/authority/country"}, {"concepts": [{"id": "decline soil biodiversity"}], "scheme": "http://aims.fao.org/aos/agrovoc/c_330883"}], "license": "registration needed", "updated": "2010-01-01", "type": "Dataset", "created": "2010-01-01", "language": "eng", "title": "Soil and Earthworm Survey", "description": "The OPAL (Open Air Laboratories) Data Explorer allows you to visualise environmental data", "formats": [{"name": "text/html"}, {"name": "canonical"}], "keywords": ["soil degradation processes", "National", "MensMeu", "UK", "decline soil biodiversity"], "contacts": [{"name": null, "organization": "Imperial College London", "position": null, "roles": ["pointOfContact"], "phones": [{"value": null}], "emails": [{"value": "opal@imperial.ac.uk )"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": "UK"}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": null, "name_url": "", "description": null, "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}]}, "links": [{"href": "https://www.opalexplorenature.org/dataexplorer/surveytype/soilsurvey", "name": "HTML", "protocol": "text/html", "rel": null}, {"href": "https://github.com/ejpsoil/ejpsoildatahub/tree/main/datasets/mensmeu/UK/Soil-and-Earthworm-Survey.yml", "name": "Source of the record", "protocol": "canonical", "rel": "canonical"}, {"rel": "self", "type": "application/geo+json", "title": "Soil-and-Earthworm-Survey", "name": "item", "description": "Soil-and-Earthworm-Survey", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/Soil-and-Earthworm-Survey"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2010-01-01T00:00:00Z"}}, {"id": "6ab178db-0ae7-4220-8408-7462eceacd2c", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[11.0, 52.0], [11.0, 54.0], [11.0, 54.0], [11.0, 52.0], [11.0, 52.0]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "soil organisms"}, {"id": "tillage"}, {"id": "tillage equipment"}, {"id": "cultivation equipment"}, {"id": "intensification"}, {"id": "anthropogenic factors"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "mouldboard ploughing"}, {"id": "intensive cultivation soil biodiversity"}, {"id": "impacts on soil fauna"}, {"id": "anthropogenic effects"}, {"id": "agricultural intensification."}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agricultural management"}, {"id": "cultivation method"}, {"id": "cultivation of agricultural land"}, {"id": "cultivation system"}, {"id": "soil biodiversity"}, {"id": "intensive farming"}], "scheme": "GEMET - Concepts, version 2.4"}, {"concepts": [{"id": "agricultural management"}, {"id": "cultivation method"}, {"id": "cultivation of agricultural land"}, {"id": "cultivation system"}, {"id": "soil biodiversity"}, {"id": "intensive farming"}], "scheme": "INSPIRE"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Centre's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Centre and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Centre and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Centre and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2022-11-18", "type": "Dataset", "created": "2022-11-08", "language": "eng", "title": "Database for meta-analysis: Reducing tillage intensity benefits the soil micro- and mesofauna in a global meta-analysis.", "description": "This dataset includes data extracted from published studies reporting results on the effects of different tillage intensities on soil fauna. The literature was systematically reviewed in compliance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis framework (\u201cPRISMA\u201d). Peer-reviewed publications were searched using the Web of Science search engine, including all available databases with the following search terms: \u201cTOPIC: (tillage OR plough* OR chisel* OR till* OR mouldboard* OR disc* OR tine* OR rotatory OR rotary OR harrow* ) AND (fauna* OR biota* OR organism* OR mesofauna* OR acari OR mite* OR enchytraeid* OR nematod* OR springtail* OR collembola*)\u201c. The resulting database covers 3459 observations from 133 publications published between 1981 and 2020.\n\nResearch domain: Ecology of Agricultural Landscapes\n\nResearch question: (1) What is the effect of reducing tillage intensity on density and diversity of soil micro- and mesofaunal communities?\n(2) What are the main pedoclimatic conditions and concurrent management practices that drive the effects of reducing tillage intensity on soil fauna i.e., fertilization regimes, soil-related (pH, organic matter, texture) and climatic factors?", "formats": [{"name": "CSV"}], "keywords": ["Soil", "soil organisms", "tillage", "tillage equipment", "cultivation equipment", "intensification", "anthropogenic factors", "opendata", "mouldboard ploughing", "intensive cultivation soil biodiversity", "impacts on soil fauna", "anthropogenic effects", "agricultural intensification.", "Boden", "agricultural management", "cultivation method", "cultivation of agricultural land", "cultivation system", "soil biodiversity", "intensive farming", "agricultural management", "cultivation method", "cultivation of agricultural land", "cultivation system", "soil biodiversity", "intensive farming"], "contacts": [{"name": "Bibiana Betancur-Corredor", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "bibiana.betancurcorredor@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "0000-0003-1942-4527", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "David J. Russell", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "david.russell@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "0000-0002-7514-4573", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": null, "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "Birgit Lang", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "birgit.lang@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org/", "protocol": null, "protocol_url": "", "name": "0000-0002-7514-4573", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=6ab178db-0ae7-4220-8408-7462eceacd2c", "rel": "download"}, {"rel": "self", "type": "application/geo+json", "title": "6ab178db-0ae7-4220-8408-7462eceacd2c", "name": "item", "description": "6ab178db-0ae7-4220-8408-7462eceacd2c", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/6ab178db-0ae7-4220-8408-7462eceacd2c"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-18T00:00:00Z"}}, {"id": "c31820a2-7b7a-4aa0-9e22-591ce4f4a28f", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[5.81, 47.26], [5.81, 54.76], [15.77, 54.76], [15.77, 47.26], [5.81, 47.26]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "soil organisms"}, {"id": "fertilizer application"}, {"id": "fertilizer combinations"}, {"id": "intensification"}, {"id": "anthropogenic factors"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "soil biodiversity"}, {"id": "impacts on soil fauna"}, {"id": "anthropogenic effects"}, {"id": "soil amendments"}, {"id": "agricultural intensification"}, {"id": "intensive farming"}, {"id": "agricultural land use"}], "scheme": "Individual"}, {"concepts": [{"id": "Soil"}], "scheme": "GEMET - INSPIRE themes, version 1.0"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Centre's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Centre and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Centre and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Centre and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2022-11-07", "type": "Dataset", "created": "2022-10-12", "language": "eng", "title": "Dataset for meta-analysis on the effects of nitrogen fertilization on nematodes, springtails, mites and earthworms.", "description": "This dataset includes data extracted from published studies that compare soil faunal communities under inorganic or organic nitrogen fertilization with unfertilized controls. The literature was systematically reviewed in compliance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis framework (\u201cPRISMA\u201d). Peer-reviewed publications reporting results on the effects of N fertilization on soil fauna were searched using the Web of Science search engine, including all available databases with the following search terms: \u201c(earthworm OR acari OR mite OR springtail OR collembola OR nematode OR fauna) AND (fertilis* OR fertiliz* OR amendment*)\u201c. The resulting database covers 3826 observations from 132 publications published between 1979 and 2020.\n\n\nResearch question: What is the response of soil fauna to nitrogen fertilization in global agroecosystems? What are the main pedoclimatic conditions and management practices that drive the response of soil fauna to nitrogen fertilization i.e., different types of fertilizer (organic and inorganic), fertilization regimes, soil factors (pH, organic matter, texture) and climatic factors?", "formats": [{"name": "CSV"}], "keywords": ["soil organisms", "fertilizer application", "fertilizer combinations", "intensification", "anthropogenic factors", "soil biodiversity", "impacts on soil fauna", "anthropogenic effects", "soil amendments", "agricultural intensification", "intensive farming", "agricultural land use", "Soil"], "contacts": [{"name": "Bibiana Betancur-Corredor", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "bibiana.betancurcorredor@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0003-1942-4527", "name_url": "", "description": "ORCID ID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Birgit Lang", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "birgit.lang@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-7514-4573", "name_url": "", "description": "ORCID ID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "David J. Russell", "organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "david.russell@senckenberg.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": null, "protocol": null, "protocol_url": "", "name": "0000-0002-0129-0375", "name_url": "", "description": "ORCID ID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": null, "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"organization": "Senckenberg Museum f\u00fcr Naturkunde G\u00f6rlitz, Bonares Center for Soil Research", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=\tc31820a2-7b7a-4aa0-9e22-591ce4f4a28f", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Locations_TICKET NR 386423.png", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "c31820a2-7b7a-4aa0-9e22-591ce4f4a28f", "name": "item", "description": "c31820a2-7b7a-4aa0-9e22-591ce4f4a28f", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/c31820a2-7b7a-4aa0-9e22-591ce4f4a28f"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2022-11-07T00:00:00Z"}}, {"id": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "type": "Feature", "geometry": {"type": "Polygon", "coordinates": [[[6.16, 50.16], [6.16, 51.32], [7.61, 51.32], [7.61, 50.16], [6.16, 50.16]]]}, "properties": {"themes": [{"concepts": [{"id": "farming"}], "scheme": "https://standards.iso.org/iso/19139/resources/gmxCodelists.xml#MD_TopicCategoryCode"}, {"concepts": [{"id": "Soil"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "AGROVOC Multilingual agricultural thesaurus"}, {"concepts": [{"id": "opendata"}, {"id": "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic"}], "scheme": "Individual"}, {"concepts": [{"id": "Boden"}, {"id": "agriculture"}, {"id": "microbiology"}], "scheme": "GEMET - Concepts, version 2.4"}], "license": "CC BY", "rights": "Restrictions applied to assure the protection of privacy or intellectual property, and any special restrictions or limitations or warnings on using the resource or metadata. Reports, articles, papers, scientific and non - scientific works of any form, including tables, maps, or any other kind of output, in printed or electronic form, based in whole or in part on the data supplied, must contain an acknowledgement of the form: \"Data reused from the BonaRes Data Centre www.bonares.de. This data were created as part of the BonaRes Module A-Project - BonaRes - Inplamint's research activities.\" Although every care has been taken in preparing and testing the data, the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre cannot guarantee that the data are correct; neither does the BonaRes Module A-Project - BonaRes - Inplamint and the BonaRes Data Centre accept any liability whatsoever for any error, missing data or omission in the data, or for any loss or damage arising from its use. The BonaRes Module A-Project - BonaRes - Inplamint and BonaRes Data Centre will not be responsible for any direct or indirect use which might be made of the data.", "updated": "2024-04-15", "type": "Dataset", "created": "2023-01-24", "language": "eng", "title": "Soil fungal community across a 52-year chronosequence of soil recultivation after open-mining in Inden, Germany", "description": "The soil fungal community was surveyed across a 52-year chronosequence of soil recultivation after open-mining, during two seasons (March-winter, July-summer). The study sites correspond to agricultural fields located within an area of 25 km 2 (6\u00b015\u20190\u2019 E to 6\u00b021\u20190\u2019 E and 50\u00b050\u20195\u2019 N to 50\u00b053\u20190\u2019 N) of an open-cast lignite mine at Inden, between Cologne, Aachen, M\u00f6nchengladbach, and D\u00fcsseldorf. The soil extraction, deposition and recultivation process leads to a chronosequence of fields recultivated from less than one year to fields recultivated for 52 years, at samling time of 2016. During the first three years, fields are permanently covered by alfalfa and never receive artificial fertilisers or biocide treatments (fields recultivated since 2016, 2015, 2014 and 2013, referred to as phase 1). In the following two years, agricultural practises are resumed with barley cropping by RWE Power AG, and a N:P:K (1:0.4:0.6) fertilisation of 437 kg ha\u22121 a\u22121 (fields recultivated since 2012 and 2011 referred to as phase 2). Afterwards, fields are returned to farmers and conventionally managed with a crop sequence of winter wheat after sugar beet, one tillage a year to 30 cm depth, and a continuous management practice following area-typical agricultural practice and plant-protection guidelines (fields recultivated since 2006, 1990, 1979, 1971 and 1964, referred to as phase 3). Other agricultural fields that have not yet been subject to extraction were sampled too (referred to as pre-mining phase). They are a total of 115 samples (5 replicates per field x 2 seasons, each field corresponds to a year of recultivation). Four samples were removed due to failed PCR. The soil fungal community was analyzed with 300 bp paired-end Illumina MiSeq sequencing of ITS2 sequences (primers fITS7: 5\u2032\u2010GTGARTCATCGAATCTTTG\u20103\u2032 / ITS4: 5\u2032\u2010TCCTCCGCTTATTGATATGC\u20103\u2032). Amplicon sequence variants (ASVs) were inferred using DADA2 in R. Taxonomic annotations were performed using the IDTaxa algorithm implemented in the DECIPHER R package, against UNITE (version of 10.05.2021). Raw sequencing reads are available at ENA under study project PRJEB51095. The DNA sequences of the fungal amplicon sequence variants are available at ENA under accession numbers OV986018-OV989728. The processed dataset including the ASV count table, ASV taxonomy, and sample metadata compiled as a phyloseq R object stored in a single .RDS R file, as well as ASV guild annotation using Funguild database, are available at figshare at (https://doi.org/10.6084/m9.figshare.20160578). To read the data in the software R, use readRDS() function). Here we upload at the BONARES data centre the relative abundance of each fungal guild (% of DNA sequences) per samples along with basic metadata for easy reuse. The guild name and metadata name is provided in the header of each column. The entire set of measured soil physico-chemical parameters has been deposited at BONARES under reference 72ca6e98-5aab-4884-bf1b-56931482eb94. The publication associated to the dataset can be found at https://doi.org/10.1007/s00248-022-02058-w. Roy J, Reichel R, Br\u00fcggemann N, Rillig MC. 2022. Functional, not Taxonomic, Composition of Soil Fungi Reestablishes to Pre   mining Initial State After 52 Years of Recultivation. Microbial Ecology. Other publications associated to the datasets are : (1) Reichel R., H\u00e4nsch M., Br\u00fcggemann N. (2017). Indication of rapid soil food web recovery by nematode-derived indices in restored agricultural soil after open-cast lignite mining. Soil Biology and Biochemistry, 115, 261-264. DOI: 10.1016/j.soilbio.2017.08.020; (2) Roy J., Reichel R., Br\u00fcggemann N., Hempel S., Rillig M. (2017). Succession of arbuscular mycorrhizal fungi along a 52-years agricultural recultivation chronosequence. FEMS Microbiology Ecology. DOI: 1093/femsec/fix102", "formats": [{"name": "CSV"}], "keywords": ["Soil", "agriculture", "microbiology", "opendata", "Agroecosystems; Fungal functional guilds; Nutrient stoichiometry; Soil biodiversity loss ; Soil reclamation; Succession; Temporal dynamic", "Boden", "agriculture", "microbiology"], "contacts": [{"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["projectLeader"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "BonaRes Data Center", "organization": "Leibniz Centre for Agricultural Landscape Research (ZALF)", "position": "Research Platform 'Data Analysis & Simulation' - Workgroup Research Data Management", "roles": ["publisher"], "phones": [{"value": "+49 33432 82 300"}], "emails": [{"value": "dataservice@zalf.de"}], "addresses": [{"deliveryPoint": ["Eberswalder Strasse 84"], "city": "M\u00fcncheberg", "administrativeArea": "Brandenburg", "postalCode": "15374", "country": "Germany"}], "links": [{"href": null}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Nicolas Br\u00fcggemann", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "n.brueggemann@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3851-2418", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Matthias Rillig", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["author"], "phones": [{"value": null}], "emails": [{"value": "rrillig@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-3541-7853", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "Julien Roy", "organization": "Freie Universit\u00e4t Berlin", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "royjulien@zedat.fu-berlin.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0003-2964-1314", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"name": "R\u00fcdiger Reichel", "organization": "Forschungszentrum J\u00fclich GmbH", "position": null, "roles": ["dataCollector"], "phones": [{"value": null}], "emails": [{"value": "ru.reichel@fz-juelich.de"}], "addresses": [{"deliveryPoint": [null], "city": null, "administrativeArea": null, "postalCode": null, "country": null}], "links": [{"href": {"url": "https://orcid.org", "protocol": null, "protocol_url": "", "name": "0000-0002-4950-5494", "name_url": "", "description": "ORCID", "description_url": "", "applicationprofile": null, "applicationprofile_url": "", "function": null}}]}, {"organization": "Forschungszentrum J\u00fclich GmbH;Freie Universit\u00e4t Berlin", "roles": ["contributor"]}]}, "links": [{"href": "https://maps.bonares.de/mapapps/resources/apps/bonares/index.html?lang=en&mid=4cf3c473-96a6-4660-b973-30c0f03c7cd2", "rel": "download"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure1.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure2.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"href": "https://metadata.bonares.de:443/smartEditor/preview/Figure3.PNG", "name": "preview", "description": "Web image thumbnail (URL)", "protocol": "WWW:LINK-1.0-http--image-thumbnail", "rel": "preview"}, {"rel": "self", "type": "application/geo+json", "title": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "name": "item", "description": "4cf3c473-96a6-4660-b973-30c0f03c7cd2", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/4cf3c473-96a6-4660-b973-30c0f03c7cd2"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-04-15T00:00:00Z"}}, {"id": "oai:zenodo.org:10624293", "type": "Feature", "geometry": null, "properties": {"license": "Open Access", "updated": "2026-08-26T16:28:35Z", "type": "Dataset", "title": "Database of soil vulnerability to natural forest disturbances", "description": "The data in this repository relate to evidence synthesis projects which aim to assess the impacts of different natural disturbances, such as fire and precipitation changes on forest soils. This work was carried out as part of the Holisoils project funded by EU Horizon 2020 program (EU Horizon 2020 Grant Agreement No 101000289).", "keywords": ["forest", "precipitation reductions", "windthrow", "precipitation increases", "natural disturbances", "soil biodiversity", "drought", "precipitation change", "insect pest", "fire"], "contacts": [{"organization": "Martin, Philip", "roles": ["creator"]}]}, "links": [{"href": "https://doi.org/oai:zenodo.org:10624293"}, {"rel": "self", "type": "application/geo+json", "title": "oai:zenodo.org:10624293", "name": "item", "description": "oai:zenodo.org:10624293", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items/oai:zenodo.org:10624293"}, {"rel": "collection", "type": "application/json", "title": "Collection", "name": "collection", "description": "Collection", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main"}], "time": {"date": "2024-02-06T00:00:00Z"}}], "links": [{"rel": "self", "type": "application/geo+json", "title": "This document as GeoJSON", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Soil+biodiversity&offset=50&f=json", "hreflang": "en-US"}, {"rel": "alternate", "type": "text/html", "title": "This document as HTML", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Soil+biodiversity&offset=50&f=html", "hreflang": "en-US"}, {"rel": "collection", "type": "application/json", "title": "Collection URL", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main", "hreflang": "en-US"}, {"type": "application/geo+json", "rel": "prev", "title": "items (prev)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Soil+biodiversity&offset=0", "hreflang": "en-US"}, {"rel": "last", "type": "application/geo+json", "title": "items (last)", "href": "https://repository.soilwise-he.eu/cat/collections/metadata:main/items?keywords=Soil+biodiversity&offset=72", "hreflang": "en-US"}], "numberMatched": 72, "numberReturned": 22, "distributedFeatures": [], "timeStamp": "2026-08-26T17:39:35.923695Z"}